View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_47 (Length: 256)
Name: NF11575_high_47
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 35409602 - 35409834
Alignment:
| Q |
10 |
gcagaacctgtgttaatcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtatctctgcggatccttgacaaaggccgcgt |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409602 |
gcagaacctatgttaatcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtatctctgcggatccttgacaaaggccgcgt |
35409701 |
T |
 |
| Q |
110 |
gatcaggaacctcctcattaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409702 |
gatcaggaacctcctcattaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatg |
35409801 |
T |
 |
| Q |
210 |
ttgcgctgatacagtccagataatggtggtaag |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35409802 |
ttgcgctgatacagtccagataatggtggtaag |
35409834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 35408243 - 35408311
Alignment:
| Q |
13 |
gaacctgtgttaatcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtat |
81 |
Q |
| |
|
|||||| |||| ||||||||||||||| || | ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35408243 |
gaacctatgttgatcacagccatgaaccttttcgcctgaaataaacttggcagtgatgacagaaagtat |
35408311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University