View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_52 (Length: 239)
Name: NF11575_high_52
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 926896 - 927135
Alignment:
| Q |
1 |
tcaaatagcttataatgcaattccgaaatggtcattattgccgctgcaattaaaaataattttatctttcccaaatttttt-atcaagtgttgttttann |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
926896 |
tcaaatagcttataatgcaattccgaaatggtcattattaccgctgcaattaaaaataattttatctttcccaaatttttttatcaagtgttgttttatt |
926995 |
T |
 |
| Q |
100 |
nnnnnacggggacacattaattaatttatattagtgtttcccaaatagtttttctctttaaaatatgttgatgttttctctcaaccctcccatttagtta |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
926996 |
tttt-acggggacacattaattaattaatattagtgtttcccaaatagtttttcacttcaaaatatgttaatgttttctctcagccctcccatttagttg |
927094 |
T |
 |
| Q |
200 |
aggtgttttcacacaag-atttttacgagggatgcctttac |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
927095 |
aggtgttttcacacaagaatttttacgagggatgcctttac |
927135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 222
Target Start/End: Original strand, 20324053 - 20324116
Alignment:
| Q |
159 |
aaaatatgttgatgttttctctcaaccctcccatttagttaaggtgttttcacacaagattttt |
222 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||| ||| ||| |||| ||||||||||||| |
|
|
| T |
20324053 |
aaaatatgttgatgtttcctctcaactctaccattttgttgaggagtttcaacacaagattttt |
20324116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 34067038 - 34066981
Alignment:
| Q |
161 |
aatatgttgatgttttctctcaaccctcccatttagttaaggtgttttcacacaagat |
218 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| ||| |||||| | ||||||||| |
|
|
| T |
34067038 |
aatatgttggtgttttctctcaaccctaccattttgttgaggtgtctcaacacaagat |
34066981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 222
Target Start/End: Original strand, 21285651 - 21285711
Alignment:
| Q |
162 |
atatgttgatgttttctctcaaccctcccatttagttaaggtgttttcacacaagattttt |
222 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
21285651 |
atatattgatgttttctttcaacaatcccattttgtttaggtgtttcaacacaagattttt |
21285711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University