View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_53 (Length: 239)
Name: NF11575_high_53
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 11312952 - 11313173
Alignment:
| Q |
1 |
cgtggctggaagtagatgttctttaacgaaggtccagatctcatacgcagtgtcaccattgatcatggtcaatacttcttccttcatggttccgagtagc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11312952 |
cgtggctggaagtagctgttctttaacggaggtccagatctcatacgcagtgtcaccattgatcatggtcaacacttcttccttcatggttccgagtagc |
11313051 |
T |
 |
| Q |
101 |
catgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttcactcgtggcacccttgacttccttttctggtttttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
11313052 |
catgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttcacccgtggcacccttgacttcctcttctggtttttctt |
11313151 |
T |
 |
| Q |
201 |
cactcaatagatggtgaagaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11313152 |
cactcaatagatggtgaagaac |
11313173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University