View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11575_high_54 (Length: 239)

Name: NF11575_high_54
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11575_high_54
NF11575_high_54
[»] chr3 (2 HSPs)
chr3 (57-117)||(42113246-42113306)
chr3 (194-239)||(42113104-42113149)


Alignment Details
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 42113306 - 42113246
Alignment:
57 gtagtatctacataaatcattgataattaagattaccccacaaaaagatgttggatggtgg 117  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
42113306 gtagtatctacataaatcattgataattaagattaccacacaaaaagatgttggatggtgg 42113246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 42113149 - 42113104
Alignment:
194 agagagagtgaggttaagcatgggagatgaataagaaagttgttat 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
42113149 agagagagtgaggttaagcatgggagatgaataagaaagttgttat 42113104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University