View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_56 (Length: 232)
Name: NF11575_high_56
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 40803097 - 40803315
Alignment:
| Q |
1 |
gaggtatcataattcatctgctaaagatgaaaccaagaatttgaaccaagagggtttaatcatgcaaaatattgctaaagctagagaccggctaagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803097 |
gaggtatcataattcatctgctaaagatgaaaccaagaatttgaaccaagagggtttaatcatgcaaaatattgctaaagctagagaccggctaagaaag |
40803196 |
T |
 |
| Q |
101 |
ttggaaaacaagaaacctgagaaaaagatagatctgcttatgcatgagtgcatgcaaaacaaaaatttggtggacaacctcactgctgaagaattgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803197 |
ttggaaaacaagaaacctgagaaaaagatagatctgcttatgcatgagtgcatgcaaaacaaaaatttggtggacaacctcactgctgaagaattgaaag |
40803296 |
T |
 |
| Q |
201 |
atttggatgaatttattga |
219 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
40803297 |
atttggatgagtttattga |
40803315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University