View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11575_high_60 (Length: 227)

Name: NF11575_high_60
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11575_high_60
NF11575_high_60
[»] chr5 (1 HSPs)
chr5 (1-143)||(26616191-26616332)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 26616332 - 26616191
Alignment:
1 gtactcataataaattacaaattattaattaacctaatactnnnnnnnnnnttagtactaattttgtatgatcttaaatgattatgggagggaaatgctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||    
26616332 gtactcataataaattacaaattattaattaacctaatactaaaaaaaaa-ttagtactaattttgtatgatcttaaatgattatgggagggaaatgctt 26616234  T
101 acttgagggtacccgtattcaggagtgtaggtagggtagctgc 143  Q
    |||||||||||||||||||||||||||||||||||||||||||    
26616233 acttgagggtacccgtattcaggagtgtaggtagggtagctgc 26616191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University