View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_34 (Length: 314)
Name: NF11575_low_34
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 104 - 307
Target Start/End: Complemental strand, 42536143 - 42535941
Alignment:
| Q |
104 |
taaaaaataaacaactcccaaagttacatcttatagaagggttgaagtccaattgaatggtgacaacagcaataacaatactactatgtggataattaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
42536143 |
taaaaaataaacaactcccaaagttacatcttatagaagggttgaagtccaattgaatggtgacaactacactaacaatactactatgtggataattaaa |
42536044 |
T |
|
| Q |
204 |
gtgtattacaaatgtagttgttagtaaattattat--agaggagtgaaaaatgtttacttttggagatcaatcgcgtgacccgcgttttaaatatctttc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
42536043 |
gtgtattacaaatgtagttgttagtaaattgttatagagaggagtgaaaaatgtttatttttggagatcaatcgcgtgac---ctttttaaatatctttc |
42535947 |
T |
|
| Q |
302 |
aatgtt |
307 |
Q |
| |
|
|||||| |
|
|
| T |
42535946 |
aatgtt |
42535941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University