View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_35 (Length: 313)
Name: NF11575_low_35
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_35 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 54076127 - 54075815
Alignment:
| Q |
1 |
caatccacaacataagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttataatgattcaccaaaccctcttcgggaccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54076127 |
caatccacaacataagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttatagtgattcaccaaaccctcttcgggaccaa |
54076028 |
T |
|
| Q |
101 |
gttgtttcgatctaaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076027 |
gttgtttcgatctaaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtg |
54075928 |
T |
|
| Q |
201 |
tctttgttccactttcctccgacacgtgtacccttgtgttaccccttctttcgggtgttgtctttgacctgatggcccaaattctaaacacatcattgac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075927 |
tctttgttccactttcctccgacacgtgtacccctgtgttaccccttctttcgggtgttgtcgttgacctgatggcccaaattctaaacacatcattgac |
54075828 |
T |
|
| Q |
301 |
acctgtccaattc |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54075827 |
acctgtccaattc |
54075815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University