View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_41 (Length: 273)
Name: NF11575_low_41
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 219 - 270
Target Start/End: Complemental strand, 22583472 - 22583421
Alignment:
| Q |
219 |
aggtgtgggggatggggttgattgaacatgtgtgttttgctgtgtgttttgc |
270 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22583472 |
aggtgtgggggatgaggttgattgaacatgtgtgttttgctgtgtgatttgc |
22583421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 219 - 270
Target Start/End: Complemental strand, 22588303 - 22588252
Alignment:
| Q |
219 |
aggtgtgggggatggggttgattgaacatgtgtgttttgctgtgtgttttgc |
270 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22588303 |
aggtgtgggggatgaggttgattgaacatgtgtgttttgctgtgtgatttgc |
22588252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University