View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_43 (Length: 270)
Name: NF11575_low_43
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 319877 - 319636
Alignment:
| Q |
12 |
gaggagcagagatgtggtggaatgataccagtgagcttattggaagataaatcaagtatttgaagcttgccattgagaccaagtttgtatggaatttcac |
111 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
319877 |
gaggaacaaagatgtggtggaatgataccagtgagcttattggaagataaatcaagtatttgaagcttcccattgagaccaagtttgtatggaatttcac |
319778 |
T |
|
| Q |
112 |
ctgtgaaattgttcatccaaaggccaagtgtgtctaaatcaggaaaatctgcaatgtagtcaggtatagaaccatgtaacctgttcaagaaaagattgag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
319777 |
ctgtgaaattgttcatccaaaggccaagtgtgtctaaatcaggaaaatcagcaatgtagtcaggtatagaaccatgtaacctgttcaagaaaagattgag |
319678 |
T |
|
| Q |
212 |
aagtgtgaggcggttgaggttgatgaactcaattgggatttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
319677 |
aagtgtgaggcggttgaggttgatgaactcaattgggatttc |
319636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 5194497 - 5194431
Alignment:
| Q |
62 |
atcaagtatttgaagcttgccattgagaccaagtttgtatggaatttcacctgtgaaattgttcatcc |
129 |
Q |
| |
|
|||||||||||||||| | ||| |||||| |||||| | |||||||||||||||||| ||||| |||| |
|
|
| T |
5194497 |
atcaagtatttgaagcatcccagtgagac-aagtttatgtggaatttcacctgtgaagttgtttatcc |
5194431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University