View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_44 (Length: 269)
Name: NF11575_low_44
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 33769289 - 33769051
Alignment:
| Q |
9 |
agcagagatacacaaatgtagtgttgcatttacttggacttcacttcactttagtgtttggtagctttcccatcaaactttttatttagcatatcagaag |
108 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769289 |
agcaaagacacacaaatgtagtgttgcatttacttggacttcactt-----tagtgtttggtagctttcccatcaaactttttatttagcatatcagaag |
33769195 |
T |
 |
| Q |
109 |
aactggtttcacagacaccatttgttagcacaggnnnnnnnnnnngctagtagaatgaagaaaaacaacacaatgtcttgtttttgcaattaaatagaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769194 |
aactggtttcacagacaccatttgttagcacagg--taaaaaaaagctagtagaatgaagaaaaacaacacaatgtcttgtttttgcaattaaatagaaa |
33769097 |
T |
 |
| Q |
209 |
aatcttacatctcgcgcagttttggaagtttctctgtggatggagg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769096 |
aatcttacatctcgcgcagttttggaagtttctctgtggatggagg |
33769051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University