View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_50 (Length: 248)
Name: NF11575_low_50
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 137
Target Start/End: Complemental strand, 12221865 - 12221745
Alignment:
| Q |
17 |
agagattaggtattctgtttcacttgaagtttattttcagcttcaaaggtgagctgaatatgaagcttaaacaatatttgtcacaatcgaggcatgaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12221865 |
agagattaggtattctgtttcacttgaagtttattttcagcttcaaaggtgagctgaatatgaagcttaaacaatatttgtcacaatcgaggcatgaaat |
12221766 |
T |
 |
| Q |
117 |
ggattggatttagcatatttg |
137 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12221765 |
ggattggatttagcatatttg |
12221745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 12221748 - 12221703
Alignment:
| Q |
198 |
tttgctaataatgtgttatatcctccaagttgagtctctaggacat |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
12221748 |
tttgctaataatgtgttgtatcctccaagatgtgtctctaggacat |
12221703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University