View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_low_8 (Length: 556)
Name: NF11575_low_8
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 22161135 - 22160869
Alignment:
| Q |
18 |
gtattctccttattctggtcacatatgagtagtggttggtatccgacaacaatgcgcctgaagttgacaaagagattaagagtttatgcacacctagaag |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22161135 |
gtattctccttattctgtccacatatgagtagtggttggtatccgacaacaatgcgcctgaagttgacaaagagattaagagtttatgcacacctagaac |
22161036 |
T |
 |
| Q |
118 |
tatttttactatcactttcgaatttgaattagtataggattttgagaaggtcaatactgaccataccagttgctactgtttgcttgcagtgttctgagaa |
217 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22161035 |
tatttttaccatcacttttgaatttgaattagtatagtattttgagaaggtcaatactgaccataccagttgctactgtttgcttgcaatgttctgagaa |
22160936 |
T |
 |
| Q |
218 |
gccaatgcaattgattgtttttgttgccgtttaacgatctgctcaagatagagtccttcaatttcag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22160935 |
gccaatgcaattgattgtttttgttgccgtttaacgatctgctcaagatagagtccttcaatttcag |
22160869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 418 - 543
Target Start/End: Complemental strand, 22160739 - 22160614
Alignment:
| Q |
418 |
agaaaattgtttattgatcaaatagaaaaatacatacttgcagtgcttgagtatcaacaccaataacatctaaggttttcccattagataaattgatctt |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22160739 |
agaaaattgtttattgatcaaatagaaaaatacatacttgcagtgcttgagtatcaacaccaataacatctaaggttttcccattagataaattgatctt |
22160640 |
T |
 |
| Q |
518 |
ctgctcaaagcaaaccacttcttctc |
543 |
Q |
| |
|
||||||||||||| |||||| ||||| |
|
|
| T |
22160639 |
ctgctcaaagcaacccacttgttctc |
22160614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University