View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11576_low_2 (Length: 329)
Name: NF11576_low_2
Description: NF11576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11576_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 18509400 - 18509188
Alignment:
| Q |
12 |
aaatagagctccctgcatacgctgagtctccacataagcctaacttaactgacacccatatattagtatgcannnnnnnnggagatgaaaatattaatag |
111 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
18509400 |
aaatcgagttccctgcatacgctgagtctccacataagcctaacttaactgacactcatatattagtatgcattttt---ggagatgaaaagattaatag |
18509304 |
T |
|
| Q |
112 |
tatatgcaccca-tagattgctcaacctgtgaaataaagcgatcggaagttatgctctgat-caaaaaatgtccatcaaatcgtaacttttgataggttt |
209 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
18509303 |
tat--gcaccccgtagattgctcaacctgtgaaataaagcgaccggaaattatgctctgatccaaaaaatgtccatcagatcgtaatctccgataggttt |
18509206 |
T |
|
| Q |
210 |
tatgtgattgggacttgt |
227 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
18509205 |
tatgcgattgggacttgt |
18509188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 295
Target Start/End: Complemental strand, 18509183 - 18509137
Alignment:
| Q |
249 |
ttttgtgcaaactgaagggcccgaacaacaaccacccttaaggacag |
295 |
Q |
| |
|
|||||||||||| |||||||||| | | ||||||||||||||||||| |
|
|
| T |
18509183 |
ttttgtgcaaaccgaagggcccgtagagcaaccacccttaaggacag |
18509137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University