View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_11 (Length: 396)
Name: NF11577_low_11
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 50 - 282
Target Start/End: Complemental strand, 21234822 - 21234584
Alignment:
| Q |
50 |
tcgtgcatgccattagtgagagtgtttgtgacatcaagattgtcaaatgttattgtcaacttgttggtcaggatgcatcagatggatatgaatgacttga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21234822 |
tcgtgcatgccattagtgagagtgtttgtgacatcaagattgtcaaatgttattttcaacttgttggtcaggatgcatcagatgaatatgaatgacttga |
21234723 |
T |
|
| Q |
150 |
gagacaatttattgaagatgtatcatatgattgactcgagaatatattattgcttttgtgtggtg----tattaaatgattattatacttacttcgatct |
245 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| || |||||| |||||| ||||||||||||||||| |
|
|
| T |
21234722 |
gagacaatttattgaaggtgtatcatatgattgactcgaggatatattattgcttttgtgtgatgtatttattaattgattagtatacttacttcgatct |
21234623 |
T |
|
| Q |
246 |
c--atatattttcccttgtattttgccctttattagata |
282 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21234622 |
catatatattttcccttgtattttgccctttattagata |
21234584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 275 - 380
Target Start/End: Complemental strand, 21234400 - 21234291
Alignment:
| Q |
275 |
attagatattgtcgaggaagagtcggtgacaatagatggagtacttcctttcattccttttacaactaacc----atagacgtatcattgtcagtgatgt |
370 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
21234400 |
attagatattgtcgaggaatagtcggtgacaatagatggagtacttcatttcattcattttacaactaaccatatatagacgtgtcattgtcactgatgt |
21234301 |
T |
|
| Q |
371 |
ggatgatttt |
380 |
Q |
| |
|
||| ||||| |
|
|
| T |
21234300 |
agataatttt |
21234291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University