View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_12 (Length: 395)
Name: NF11577_low_12
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 1 - 379
Target Start/End: Original strand, 52577697 - 52578075
Alignment:
| Q |
1 |
ccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaacaagcattttaattgaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52577697 |
ccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaactagcattttaattgaggg |
52577796 |
T |
 |
| Q |
101 |
gaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggtttcctgaatgcgataagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577797 |
gaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggtttcctgaatgcgataagta |
52577896 |
T |
 |
| Q |
201 |
tgtggtgtctaaccaaccctttgcttcatctccgagaagcttaaatggaactggatatggaactttaaatggaagaaatttgaaagaaaaggcagctctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577897 |
tgtggtgtctaaccaaccctttgcttcatctccgagaagcttaaatggaactggatatggaactttaaatggaagaaatttgaaagaaaaggcagctctg |
52577996 |
T |
 |
| Q |
301 |
tcaaacctaaaaaggattctttttccatctccaatggatgctgctgcctatttaaattgaaggacatgagtataagaac |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577997 |
tcaaacctaaaaaggattctttttccatctccaatggatgctgctgcctatttaaattgaaggacatgagtataagaac |
52578075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University