View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_13 (Length: 374)
Name: NF11577_low_13
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 38005691 - 38005509
Alignment:
| Q |
14 |
aacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagttgttttacaaca |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
38005691 |
aacatcgttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcggcattgcatttgagttgttttacaaca |
38005592 |
T |
|
| Q |
114 |
aaatctcgcaaatgccagttgcaccaaaaattgatttttgtaagttttgtaagatttgggctggtgaagatggtgacatgtat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005591 |
aaatctcgcaaatgccagttgcaccaaaaattgatttttgtaagttttgtaagatttgggctggtgaagatggtgacatgtat |
38005509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 295 - 359
Target Start/End: Complemental strand, 38005401 - 38005337
Alignment:
| Q |
295 |
cggtagggttccaatgccatgggaattgttgcaaccagttttgagaatattgggacattgtttgt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005401 |
cggtagggttccaatgccatgggaattgttgcaaccagttttgagaatattgggacattgtttgt |
38005337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 26462122 - 26462304
Alignment:
| Q |
14 |
aacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagttgttttacaaca |
113 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
26462122 |
aacatcgttgttttatcgccttcgcttgagccacacggcactgttcggtcaacacgaagagctcgaatcgtaggcattgcattcgagttgttttacagca |
26462221 |
T |
|
| Q |
114 |
aaatctcgcaaatgccagttgcaccaaaaattgatttttgtaagttttgtaagatttgggctggtgaagatggtgacatgtat |
196 |
Q |
| |
|
|||| || ||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26462222 |
aaatatctgaaatgcctgtttcaccaaaaattgatttttgtaacttttgtaagatttgggctggtgaagatggtgacatgtat |
26462304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 296 - 359
Target Start/End: Original strand, 26462407 - 26462470
Alignment:
| Q |
296 |
ggtagggttccaatgccatgggaattgttgcaaccagttttgagaatattgggacattgtttgt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26462407 |
ggtagggttccaatgccatgggaattgttacaaccagttttgagaatattgggacattgtttgt |
26462470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University