View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_15 (Length: 368)
Name: NF11577_low_15
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 22 - 359
Target Start/End: Original strand, 40510750 - 40511087
Alignment:
| Q |
22 |
acgattcctaatttagatgagagagagctgggctcaaaattgttgcaacctaacgcaatgtgaatgagaagatgctattccagcccttgtatattgaaga |
121 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
40510750 |
acgattcctaatttggatgggagagagctgggctcaaaattgttgcaacctaacgtaatgtgaatgacaagatgccattccagcccttgtatattgaaga |
40510849 |
T |
|
| Q |
122 |
tgataataaaacttttctccgtgcttcaccaaaatccttgatccctaaaacctagcagaactaagatggacttataaatgtggctgtatgagatagcatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40510850 |
tgataataaaacttttctccgtgcttcaccaaaatccttgatccctaaaacctagcagaactaagatggacttagaaatgtggctgtatgagatagcatc |
40510949 |
T |
|
| Q |
222 |
gtgctgccatctggtctgaggtgaaggctcaaagttgacctattgatgtgaggaaggcattttacgttcaggtccagagaaaagttgatcaatttgtggt |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510950 |
gtgctgccatctggtcttaggtgaaggctcaaagttgacctattgatgcgaggaaggcattttacgttcaggtccagagaaaagttgatcaatttgtggt |
40511049 |
T |
|
| Q |
322 |
ttcctaattcatcaagacaaagtatgaccctacctttg |
359 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40511050 |
ttccaaattcatcaagacaaagtatgaccctacctttg |
40511087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University