View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_25 (Length: 308)
Name: NF11577_low_25
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 18079504 - 18079213
Alignment:
| Q |
1 |
ttggcgtaacaacagttccacttccatcttgaacatcccttggacaaccaactgcaaccttcttcatttgagtcttttcttcaccaaaggttgcatcttt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18079504 |
ttggagtaacaacagttccacttccatcatgaacatcccttggagaaccaactgcaaccttcttcatttgagtcttttcttcaccaaaggttgcatcttt |
18079405 |
T |
 |
| Q |
101 |
tggaaatggtggctcaaccattcttgactttggctttgaaaattcagacctagccaagaaagtgcttgttgtaggaacttgaacattgcttcttctgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18079404 |
tggaaatggtggctcaaccattcttgactttggctttgaaaattcagacctagccaagaaagtgcttgttgtaggaacttgaacattgcttcttctgaga |
18079305 |
T |
 |
| Q |
201 |
ttctcaagctccatgagttctgcttctgcatgtgacccttttggagacggagatgaacccatcttggaaatgagctgaggagagtaggaact |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
18079304 |
ttctcaagctccatgagttctgcttctgcatgtgatccttttggagatggagatgaacccgtcttggaaatgaactgaggagagtaggaact |
18079213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University