View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_29 (Length: 282)
Name: NF11577_low_29
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 37659640 - 37659389
Alignment:
| Q |
20 |
ctatcggcaccaggtgagttctgaatagagtatgttgcatattttgttccttatgataaatgcatatctaaacaagaaataaagatgaatcatatgaccg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37659640 |
ctatcggcaccaggtgagttctgaatagagtatgttacatattttgttccttatgataaatgcatatctaaacaagaaataaagatgaatcatatgaccg |
37659541 |
T |
|
| Q |
120 |
aactgacatttagtatactgctttattgcttcacgtattgtattactattacactatttcaccactttttccgcataaacatactaacttattaagcaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37659540 |
aactgacatttagtatactgctttattgcttcacgtattgtattactattacactatttcaccactttttccgcataaacatactaacttattaagcaaa |
37659441 |
T |
|
| Q |
220 |
tatatatcatcattttgtttctgattatgcttgattagcagttctttttctt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37659440 |
tatatatcatcattttgtttctgattatgcttgattagcagttctttttctt |
37659389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University