View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_32 (Length: 276)
Name: NF11577_low_32
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 16910232 - 16910492
Alignment:
| Q |
1 |
gtaaaagagatgaaaaagaaatagaaaaagaccggcttagtgacttgtgtgattctgttttgctcaatatgatgaagtttatggacacaaaacaagttgt |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16910232 |
gtaaaagagataaaaaagaaagagaaaaagaccggcttagtgacttgtgtgattctgttttgctcaatataatgaagtttatggacacaaaacaagttgt |
16910331 |
T |
|
| Q |
101 |
tcaaacttgtgtattgtctactagatggaagacactttggcgaagagtcacgactcttgcattgaataattcagtattcgctcgtggcttaccgaattat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16910332 |
tcaaacttgtgtattgtctactagatggaagacactttggcgaagagtcactactcttgcattgaataattcagtattcgctcgtggcttacccaattat |
16910431 |
T |
|
| Q |
201 |
aatcaatttgtgttttcagttctgtctcatcgtgacaaatcaatttctttacaagatattg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910432 |
aatcaatttgtgttttcagttctgtctcatcgtgacaaatcaatttctttacaagatattg |
16910492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University