View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_42 (Length: 239)
Name: NF11577_low_42
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 31949153 - 31949289
Alignment:
| Q |
1 |
taaactcaaactaatgtcattaactagcatccctatcaacccaatctttcccaaactaacaactatatttcacccgatgtgaagtaataatcacctaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31949153 |
taaactcaaactaatgtcattaactagcatccctatcaacccaatcttacccaaactaacaactatatttcacccgatgtgaagtaataatcacctaatc |
31949252 |
T |
 |
| Q |
101 |
aattgtagtattgtgcgtaataaacagtaaaaaaacc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31949253 |
aattgtagtattgtgcgtaataaacagtaaaaaaacc |
31949289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Original strand, 31949348 - 31949377
Alignment:
| Q |
193 |
tctgctaatcccgtgtgttttgatttagac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31949348 |
tctgctaatcccgtgtgttttgatttagac |
31949377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University