View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11577_low_44 (Length: 202)
Name: NF11577_low_44
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11577_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 2376770 - 2376934
Alignment:
| Q |
19 |
aaccatgaaaatgtagaaactttcaccacatttgaaagagaggaagaagnnnnnnnnncctactaattttgtgttctatgaaaaatgcactcttgataac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2376770 |
aaccatgaaaatgtagaaactttcaccacatttgaaagagaggaagaaaaaaaaaa---ctactaattttgtgttctatgaaaaatgtactcttgataac |
2376866 |
T |
 |
| Q |
119 |
ttatggcttctgaaagtgcacttataaaaacgtgtgtaaaatagaaattaaccttaaataaattgatc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2376867 |
ttatggcttctgaaagtgcacttataaaaaagtgtgtatgatagaaattaaccttaaataaattgatc |
2376934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University