View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11578_high_2 (Length: 544)
Name: NF11578_high_2
Description: NF11578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11578_high_2 |
 | |
|
| [»] scaffold0018 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 5e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 5e-79
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 31053619 - 31053450
Alignment:
| Q |
17 |
acatcagggagtagaagcttctctaaatcgtcttcttcttctaagatgcaaacatgcatatcatatacacaaacgagtcaaacaacatacataacaatac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31053619 |
acatcagggagtagaagcttctctaaatcgtcctcttcttctaagatacaaacatgcatatcatatatacaaacgagtcaaacaacatacataacaatac |
31053520 |
T |
|
| Q |
117 |
aatataattaagtttcttttgagtacgcatcagttggtagcacaaacatagtagaggtgcaggaagacat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
31053519 |
aatataattaagtttcttttgagtacgcatcagttggtagcacaaacatagtagaggtacaggacgacat |
31053450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 364 - 526
Target Start/End: Complemental strand, 31053452 - 31053298
Alignment:
| Q |
364 |
catatgtcatgcttgtaattgcatatggtcaaatgcaattgagatgaattttatcatacttcgcttaagcttcatatttaaatggaacaaatgtaatatg |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053452 |
catatgtcatgcttgtaattgcatatggtcaaatgcaattgagatgaattttatcatacttcgcttaagcttcatatttaaatggaacaaatgtaatatg |
31053353 |
T |
|
| Q |
464 |
gtcgctcgtaattataccattcggtttgctttagaactgatacgatagcttgcagctcgtaat |
526 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053352 |
gtcgctcgta--------attcggtttgctttagaactgatacgatagcttgcagctcgtaat |
31053298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 146; Significance: 1e-76; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 377 - 526
Target Start/End: Original strand, 169802 - 169951
Alignment:
| Q |
377 |
tgtaattgcatatggtcaaatgcaattgagatgaattttatcatacttcgcttaagcttcatatttaaatggaacaaatgtaatatggtcgctcgtaatt |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
169802 |
tgtaattgcatatggtcaaatgcaattgagatgaattttatcatacttcgcttaagcttcatatttaaatgaaacaaatgtaatatggtcgctcgtaatt |
169901 |
T |
|
| Q |
477 |
ataccattcggtttgctttagaactgatacgatagcttgcagctcgtaat |
526 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
169902 |
ataccattcggtttgctttagaactgatacgatagcttgcagctcgtaat |
169951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 199 - 258
Target Start/End: Original strand, 169673 - 169732
Alignment:
| Q |
199 |
tatgataagtaatagaaaacaatacaattcctttttgaacattatgagattctgacatag |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
169673 |
tatgataagtaatagaaaacaatacaattcctttttgaacattatgagattttgacatag |
169732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 53452218 - 53452256
Alignment:
| Q |
17 |
acatcagggagtagaagcttctctaaatcgtcttcttct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53452218 |
acatcagggagtagaagcttctctaaatcatcttcttct |
53452256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University