View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11578_low_14 (Length: 220)
Name: NF11578_low_14
Description: NF11578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11578_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 32 - 201
Target Start/End: Original strand, 36402681 - 36402850
Alignment:
| Q |
32 |
cacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402681 |
cacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaat |
36402780 |
T |
 |
| Q |
132 |
cttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402781 |
cttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccacc |
36402850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 36 - 194
Target Start/End: Original strand, 21428795 - 21428953
Alignment:
| Q |
36 |
tacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaatctta |
135 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| ||| ||||||| |||||||| |||||||| || || || ||||||||||||| |||| |
|
|
| T |
21428795 |
tacctcaactttcatcatccatgaattagctttctgaacctgctcattctcccaaccattgataacagcatcttcccttttaaacctgttattaacctta |
21428894 |
T |
 |
| Q |
136 |
gcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccct |
194 |
Q |
| |
|
||||| ||||| || ||||| || | |||||| | ||||| || || ||||||||||| |
|
|
| T |
21428895 |
gcaaccttagcgttttgccatgcagctatcttggactcaacctcttctttcttcaccct |
21428953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University