View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11578_low_5 (Length: 420)
Name: NF11578_low_5
Description: NF11578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11578_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 9 - 403
Target Start/End: Original strand, 40502043 - 40502438
Alignment:
| Q |
9 |
acgttggaaactcattctagtgatcatctggtcgagaggtgagaactcagcaaagaacagaggtctctgggtcgtttcttgttgattctacaacacaatc |
108 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502043 |
acgttggaaactcatgctagtggtcatttggtcgagaggtgagaactcagcaaagaacaaaggtctctgggtcgtttcttgttgattctacaacacaatc |
40502142 |
T |
|
| Q |
109 |
gggtggaattcgatgcctttgggattattcgagttggcatgtgga-gttttagagtgttagctggaaagggtaaacttcttggcttttaacaaagaagac |
207 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502143 |
gggtggcattcgatgtctttgggattatttgagttggcatgtggaagttttagagtgttagctggaaagggtaaacttcttggcttttaacaaagaagac |
40502242 |
T |
|
| Q |
208 |
ggtctttcaaatttcaaaataagttggaagggcaacaaatgatttgccaaaataatcattcatcaaaccttggtgatcactgagagtcttcttgtgcaac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502243 |
ggtctttcaaatttcaaaataagttggaagggcaacaaatgatttgccaaaaaattcattcatcaaaccttggtgatcactgagagtcttcttgtgcaac |
40502342 |
T |
|
| Q |
308 |
gacgatgttgtggtactcagagttgttgctcacaatgatctaatcttgtacatcaaatcaaactgtgatagtgctgtttgcaacttgggaaatgat |
403 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502343 |
gacgatgttgtggtactcggagttgttgctcacaatgatctaatcttgtacatcaaatcaaactgtgatagtgctgtttgcaacttgggaaatgat |
40502438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University