View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_high_10 (Length: 401)
Name: NF11579_high_10
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 4680463 - 4680233
Alignment:
| Q |
13 |
tggacatcagaaatttcaaatgtttagtcttttttgacctatcacatgaaacatccgatgattgtttaaaaacttcaaatgacaaacatgatttcaggac |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680463 |
tggacttcagaaatttcaaatgtttagtctttttttacctatcacatgaaacatccgatgattgtttaaaaacttcaaatgacaaacatgatttcaggac |
4680364 |
T |
 |
| Q |
113 |
agaagactggtggacaagaacttgttggtggacttgattgtactgtgcacagaaatttctttggcagccaggtaatgcatgcatttgatatggctcctta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680363 |
agaagactggtggacaagaacttgttggtggacttgattgtactgtgcacaggaatttctttggcagccaggtaatgcatgcatttgatatggctcctta |
4680264 |
T |
 |
| Q |
213 |
atggggtagcaatatcagatagcacaatcag |
243 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
4680263 |
acggggtagcaatatcagatagcacaatcag |
4680233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 4680164 - 4680093
Alignment:
| Q |
311 |
aacataatcctttattgattgattgtattcagcattatcatttaattgatcaagtccaatatctctttcctt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680164 |
aacataatcctttattgattgattgtattcagcattatcatttaattgatcaagtccaatatctctttcctt |
4680093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University