View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11579_high_16 (Length: 316)

Name: NF11579_high_16
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11579_high_16
NF11579_high_16
[»] chr8 (1 HSPs)
chr8 (31-84)||(22552201-22552254)
[»] chr4 (1 HSPs)
chr4 (205-233)||(33962309-33962337)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
31 ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga 84  Q
    |||||||||||||||||| ||||  |  ||||||||||||||||||||||||||    
22552254 ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga 22552201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 233
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
205 aaaaaatgggggagattgcagcatttgtt 233  Q
    |||||||||||||||||||||||||||||    
33962337 aaaaaatgggggagattgcagcatttgtt 33962309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University