View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_high_19 (Length: 271)
Name: NF11579_high_19
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 26 - 207
Target Start/End: Complemental strand, 42846928 - 42846749
Alignment:
| Q |
26 |
gagggagggagtaatagaatagaataaaaatcacttgacagacagcataatgctctaattcagttttaagctttcaaacattaagtcccacatcgta--- |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||| ||| |
|
|
| T |
42846928 |
gagggagggaataatagaatagaataaaaatcacttgacagacagcataatgctctaattcatttttaa---ttcaaacat--agtcccacattgtagag |
42846834 |
T |
 |
| Q |
123 |
ttgtgaggaatagagttcaaaatttcctataaaacagcaccgtttgctatagaaatacctaactggataagagaatgccaggcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42846833 |
ttgtgaggaatagagttcaaaatttcctataaaacagcaccgtttgctgtagaaatacctaactggataagagaatgccaggcaa |
42846749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University