View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_high_22 (Length: 250)
Name: NF11579_high_22
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 42084822 - 42085043
Alignment:
| Q |
11 |
catagggaagggaatttgaaaggaaaagatggtaaagggttgttaatgtttgaggaaccaacaacaaaactgcagcaagatgagagtgccattgttattg |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42084822 |
catagggaagggaatttgaaagtaaaagatggtaaagggttgttaatgtttgaggaacaaacaacaaaactgcagcaagatgagagtgccattgttattg |
42084921 |
T |
 |
| Q |
111 |
ttatgtaacataacacaaaatcagttttggtagttaattcgttgtgtggtggtaactaactgttatggatcagttttgtcgatt----aagaaaatagtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42084922 |
ttatgtaacataacacaaaatcagttttggtagttaattcgttgtgtggtggtaactaactgttatggatcagttttgtcgattaagaaagaaaatagtt |
42085021 |
T |
 |
| Q |
207 |
taatattatgaataagaaaatg |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42085022 |
taatattatgaataagaaaatg |
42085043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University