View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_high_26 (Length: 222)
Name: NF11579_high_26
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_high_26 |
 |  |
|
| [»] scaffold0229 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0229 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 16674 - 16548
Alignment:
| Q |
1 |
atggtaaaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16674 |
atggtaaaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaac |
16575 |
T |
 |
| Q |
101 |
ataaacaaagatgaacggaatgctgag |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16574 |
ataaacaaagatgaacggaatgctgag |
16548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 1401684 - 1401810
Alignment:
| Q |
1 |
atggtaaaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1401684 |
atggtaaaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaac |
1401783 |
T |
 |
| Q |
101 |
ataaacaaagatgaacggaatgctgag |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1401784 |
ataaacaaagatgaacggaatgctgag |
1401810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University