View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_high_28 (Length: 212)
Name: NF11579_high_28
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_high_28 |
 |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
| [»] scaffold0236 (2 HSPs) |
 |  |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |  |
|
| [»] scaffold1301 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (1 HSPs) |
 |  |  |
|
| [»] scaffold0767 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold2010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 8e-57; HSPs: 185)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 4133022 - 4133218
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc-ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcggg |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4133022 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcccttgttgttactatgaggactgaacttttgatgccactgtacaaacagtcagg |
4133121 |
T |
 |
| Q |
100 |
tgttactcactatcnnnnnnnatgctagtgttaacttcaccnnnnnnnntcattctgatgacttcaccataaaattttccataaaataattgttcaaat |
198 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4133122 |
tattactcactatc-ttttttatgctagtgttaacttcacc-aaaaaagtcattctgatgacttgaccataaaattttccataaaataattgttcaaat |
4133218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42906418 - 42906370
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42906418 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
42906370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 27082898 - 27082961
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27082898 |
ttgatgatactatgaggactgaacttttaatgccactgcacaaacagtggggtgttactcacta |
27082961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 30359109 - 30359160
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30359109 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagccttgat |
30359160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 112
Target Start/End: Original strand, 6098585 - 6098642
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
6098585 |
tactatggggactgaacttttgatgtcactgtacaaacagtggggtgttactcactat |
6098642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 12876239 - 12876178
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
12876239 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagttgggtgttactcac |
12876178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8870305 - 8870257
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8870305 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
8870257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 37205808 - 37205856
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37205808 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
37205856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1657652 - 1657699
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1657652 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
1657699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 6107163 - 6107116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6107163 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
6107116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14032082 - 14032035
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14032082 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
14032035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20095732 - 20095685
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20095732 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
20095685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20791265 - 20791312
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20791265 |
taaccgcaacttttggaaagatagaggtccaaaaatgcaattaagcct |
20791312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 25250213 - 25250256
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25250213 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
25250256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30845827 - 30845874
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30845827 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
30845874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 32332185 - 32332138
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32332185 |
aaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
32332138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38593233 - 38593186
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38593233 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
38593186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 38593452 - 38593499
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38593452 |
taaccgcaacttttggaaatatagaggtccaaaagtgcaattaagcct |
38593499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39616818 - 39616865
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39616818 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
39616865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42267725 - 42267772
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42267725 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
42267772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42906641 - 42906688
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42906641 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
42906688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 45209022 - 45208979
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45209022 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
45208979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 414713 - 414667
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
414713 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
414667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 5734452 - 5734498
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5734452 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
5734498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 7151109 - 7151155
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7151109 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
7151155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 20095954 - 20096000
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20095954 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
20096000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 20283942 - 20283988
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20283942 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
20283988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21070570 - 21070616
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21070570 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
21070616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39515604 - 39515558
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39515604 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
39515558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 40918641 - 40918687
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40918641 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
40918687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 465972 - 465911
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| | |||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
465972 |
ttgatgatactaaggggactgaatttttgatgccactgtacaaacagtggggtgttactcac |
465911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 6107384 - 6107429
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6107384 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
6107429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 36695026 - 36695087
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
36695026 |
ttgatgatactatggggactgaacttttgatgtcattgtacaaacagtggggtgttactcac |
36695087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2321562 - 2321514
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2321562 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
2321514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7013617 - 7013665
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7013617 |
taaccgcaacttttgaaaagatagagatccaaaagtgcaattaagcctt |
7013665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17943404 - 17943356
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
17943404 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
17943356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 20791062 - 20791018
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20791062 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
20791018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20819798 - 20819750
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20819798 |
taaccgcaacttttgaaaagatagtggtccaaaagtgcaattaagcctt |
20819750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 23234047 - 23234095
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23234047 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
23234095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 23854491 - 23854551
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || || ||||||||| |||||||||||| |
|
|
| T |
23854491 |
ttgatgatactatgaggactgaacttttgatgtcattgcacaaacagttgggtgttactca |
23854551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27822921 - 27822873
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27822921 |
taaccgcaaattttggaaagataggggtccaaaagtgcaattaagcctt |
27822873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31191737 - 31191785
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31191737 |
taaccgcaacttttaaaaagatagaggtccaaaagtgcaattaagcctt |
31191785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32318773 - 32318821
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32318773 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
32318821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 36788300 - 36788256
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36788300 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
36788256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 37970579 - 37970639
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
37970579 |
ttgatgatactatgagggctgaacttttgatggcattgtacaaacagtggggtgttactca |
37970639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 38166530 - 38166486
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38166530 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
38166486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 38166753 - 38166797
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38166753 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
38166797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43658448 - 43658496
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
43658448 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
43658496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 414922 - 414969
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
414922 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
414969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1985836 - 1985879
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1985836 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
1985879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4132800 - 4132753
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
4132800 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagcct |
4132753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 5300006 - 5300053
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5300006 |
ttgatgatactataaggactgaacttttgatgccactgtacaaacagt |
5300053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 6014465 - 6014418
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6014465 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
6014418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 15187974 - 15187927
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15187974 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
15187927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20820019 - 20820066
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
20820019 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcct |
20820066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29233772 - 29233819
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29233772 |
taaccgcaacttttaaaaagatagaggtccaaaagtgcaattaagcct |
29233819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 33881354 - 33881397
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33881354 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaa |
33881397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 34895097 - 34895034
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
34895097 |
ttgatgatagtatgatgactgaacttttgatgccactttacaaacagtggagtgttactcacta |
34895034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36226682 - 36226729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36226682 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
36226729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37953420 - 37953373
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37953420 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
37953373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 41362645 - 41362582
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| |||| |||||| ||| ||||||||||||||| |
|
|
| T |
41362645 |
ttgatgatactatgaggtctgaacttttgatgtcactatacaaatagtggggtgttactcacta |
41362582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42642355 - 42642402
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42642355 |
taaccgcaacctttggaaagataggggtccaaaagtgcaattaagcct |
42642402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 43657538 - 43657491
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
43657538 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
43657491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45106481 - 45106434
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45106481 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
45106434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 1205056 - 1204994
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
1205056 |
tgatgatactatgaggactgaacttttgatgtcattgtacaaacagtgatgtgttactcacta |
1204994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2321784 - 2321830
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2321784 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcc |
2321830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 4107115 - 4107161
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4107115 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
4107161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 4167467 - 4167513
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4167467 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
4167513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 6641865 - 6641911
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6641865 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
6641911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 6745263 - 6745309
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6745263 |
accgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
6745309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 106
Target Start/End: Complemental strand, 11727154 - 11727096
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
11727154 |
ttgatgatattatgaggactgaacttttgatgccactatacaaatagtggggtgttact |
11727096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14024307 - 14024353
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
14024307 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcc |
14024353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 18553238 - 18553284
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18553238 |
taaccgcaacttttggaaagataggggtccaaaattgcaattaagcc |
18553284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 20814008 - 20814054
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20814008 |
taaccgcaagttttggaaagataggggtccaaaagtgcaattaagcc |
20814054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 23233827 - 23233781
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23233827 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
23233781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 30358889 - 30358843
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
30358889 |
taaccgcaacttttgaaaagatcgaggtccaaaagtgcaattaagcc |
30358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 30845600 - 30845554
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
30845600 |
taaccgcaacttttggaaagataggggtccaaaagtacaattaagcc |
30845554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 31190689 - 31190643
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
31190689 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
31190643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35735549 - 35735504
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35735549 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaagcc |
35735504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39626235 - 39626281
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39626235 |
taaccgcagcttttggaaagataggggtccaaaagtgcaattaagcc |
39626281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39635785 - 39635831
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39635785 |
taaccgcagcttttggaaagataggggtccaaaagtgcaattaagcc |
39635831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 41554653 - 41554603
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttga |
51 |
Q |
| |
|
||||||||||||||| ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
41554653 |
taaccgcaacttttgaaaagataaaggtccgaaagtgcaattaagccttga |
41554603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 42866360 - 42866406
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42866360 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
42866406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 6335378 - 6335333
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
6335378 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagc |
6335333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 9864278 - 9864217
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| || |||| ||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
9864278 |
ttgatgatattatggggactgaacttttgatgtcattgtacaaacagtggggtgttactcac |
9864217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 36801443 - 36801398
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36801443 |
taaccgcaacttgtggaaagataggggtccaaaagtgcaattaagc |
36801398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 38644108 - 38644047
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
38644108 |
ttgatgatactatggagactgaacttttgatgccactagacaaacagtggggtgttactcac |
38644047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 40862534 - 40862489
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
40862534 |
gactgaacttttgatgccattgtacaaacagtggggtgttactcac |
40862489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 995039 - 994991
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
995039 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcctt |
994991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 1149692 - 1149752
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| || |||||||||||| || ||||||||| |
|
|
| T |
1149692 |
ttgatgatactatgaggacagaacttttgatgtcattgtacaaacagtgggttgttactca |
1149752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 1985615 - 1985567
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1985615 |
taaccgcaactattgaaaagatagaggtccaaaagtacaattaagcctt |
1985567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 6641642 - 6641598
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
6641642 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaag |
6641598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8287871 - 8287919
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
8287871 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaactaagcctt |
8287919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8870528 - 8870576
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
8870528 |
taaccgcaacttttggaaagataggggttcaaaaatgcaattaagcctt |
8870576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 10555262 - 10555322
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| || |||||||||||| | |||||||||| |
|
|
| T |
10555262 |
ttgatgatactatgaggattgaacttttgatgtcattgtacaaacagtggagtgttactca |
10555322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12330119 - 12330071
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
12330119 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaaacctt |
12330071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35409759 - 35409711
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
35409759 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaaacctt |
35409711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 37953640 - 37953688
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
37953640 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaaacctt |
37953688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39515821 - 39515869
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
39515821 |
taaccgcaacttttggaaagataggagtccaaaagtacaattaagcctt |
39515869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 41206208 - 41206164
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41206208 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaag |
41206164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 41206399 - 41206447
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
41206399 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
41206447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 41625506 - 41625458
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
41625506 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcctt |
41625458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45209243 - 45209291
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45209243 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcctt |
45209291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3345641 - 3345684
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
3345641 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaa |
3345684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4146831 - 4146784
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
4146831 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
4146784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 4147051 - 4147094
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4147051 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaa |
4147094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 6335599 - 6335642
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6335599 |
cgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
6335642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 16446935 - 16446998
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || |||| ||||| |||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
16446935 |
ttgatgatagtatggggactaaacttttgatgccattatacaaacagtggggtgttactcacta |
16446998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 16531516 - 16531563
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
16531516 |
taaccgcaacttttgaaaagataggggtctaaaagtgcaattaagcct |
16531563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20813782 - 20813735
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||||||| |
|
|
| T |
20813782 |
taaccgcaacttttgaaaagataggggtccacaagtgcaattaagcct |
20813735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 27339589 - 27339542
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27339589 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcct |
27339542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 27872756 - 27872709
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
27872756 |
taaccgcaacttttagaaagatagggatccaaaagtgcaattaagcct |
27872709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28595976 - 28595933
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
28595976 |
taaccgcaacttttgaaaagatagaggttcaaaagtgcaattaa |
28595933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29233588 - 29233545
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
29233588 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaa |
29233545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32692981 - 32693028
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32692981 |
taaccgcaatttttggaaagataggggtccaaaagtacaattaagcct |
32693028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 37639552 - 37639505
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
37639552 |
aacctcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
37639505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 106
Target Start/End: Original strand, 39099186 - 39099237
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||| |||||||||| |
|
|
| T |
39099186 |
tactatgaggactgaacttttgatgctagtgtacaaagagtggggtgttact |
39099237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 41015058 - 41015101
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
41015058 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
41015101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 41693319 - 41693366
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
41693319 |
taaccgcaacttttggaaagataaggatccaaaagtgcaattaagcct |
41693366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42267502 - 42267455
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
42267502 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
42267455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42866198 - 42866151
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
42866198 |
taaccgcaacttttgaaaagatagagatctaaaagtgcaattaagcct |
42866151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 44886171 - 44886214
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
44886171 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
44886214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 6655547 - 6655593
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
6655547 |
accgcaacttttggaaagatagggatccaaaaatgcaattaagcctt |
6655593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 6735949 - 6735995
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
6735949 |
accgcaacttttggaaagatagggatccaaaaatgcaattaagcctt |
6735995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 9 - 47
Target Start/End: Original strand, 7318910 - 7318948
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7318910 |
acttttggaaagataggggtccaaaagtgcaattaagcc |
7318948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8833988 - 8833942
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
8833988 |
taaccgcaactttttgaaagataggtgtccaaaagtgcaattaagcc |
8833942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 13307746 - 13307692
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
13307746 |
tactatggggactgaacttttgatgtcactgtacaaatagtgaggtgttactcac |
13307692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 18531100 - 18531146
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
18531100 |
taaccgtaacttttagaaagataggggtccaaaagtgcaattaagcc |
18531146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 34952106 - 34952152
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
34952106 |
ggactgaacttttgatgtcactgtacaaacagtgggctgttactcac |
34952152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 41554855 - 41554901
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
41554855 |
aaccgcaacttttagaaagatagggatccaaaagtgcaattaagcct |
41554901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 45480319 - 45480365
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
45480319 |
taaccgcaacttttggaaagataggggtccaaaagtacagttaagcc |
45480365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 1657434 - 1657389
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1657434 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagc |
1657389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 3340112 - 3340071
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3340112 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaatt |
3340071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 14032300 - 14032345
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14032300 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagc |
14032345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29454390 - 29454344
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29454390 |
taaccgcaacttttggaaaga--ggggtccaaaagtgcaattaagcctt |
29454344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 33947084 - 33947043
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
33947084 |
caacttttggaaagataggggtccaaaagtacaattaagcct |
33947043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 42524975 - 42525024
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
42524975 |
taaccgcaacttttggaaagatagggggtccaaaagtgcaattaaacctt |
42525024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 995261 - 995305
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
995261 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaag |
995305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 1150165 - 1150225
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| | |||||||||||| || ||||||||| |
|
|
| T |
1150165 |
ttgatgatactatgatgactgaacttttgatgtcgttgtacaaacagtgggatgttactca |
1150225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5734230 - 5734182
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
5734230 |
taaccgcaacttttgaaaagataggggttcaaaaatgcaattaagcctt |
5734182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 8834206 - 8834250
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
8834206 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaag |
8834250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 16222993 - 16222949
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaac |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16222993 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaac |
16222949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 17943606 - 17943654
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
17943606 |
taaccgtaacttttggaaagataggggtcctaaagtgcaatttagcctt |
17943654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 41574423 - 41574467
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41574423 |
cgcaacttttagaaagataggggtccaaaagtgcaattaaacctt |
41574467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42363624 - 42363580
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42363624 |
taacagcaacttttggaaagataagggtccaaaagtgcaattaag |
42363580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 102
Target Start/End: Original strand, 1954057 - 1954104
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
1954057 |
tactatgagggctgaacttttgatgccactgtccaaatagtagggtgt |
1954104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 6014685 - 6014732
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
6014685 |
taaccgcaacttttaaaaagatagggatccaaaagtgcaattaagcct |
6014732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 7013394 - 7013347
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| | || ||||||||||||||||||| |
|
|
| T |
7013394 |
aaccgcaacttttgaaaagatagggatctaaaagtgcaattaagcctt |
7013347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7653623 - 7653669
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7653623 |
taaccgcaacttttggaa-gataagggtccaaaagtgcaattaagcct |
7653669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 14024238 - 14024195
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
14024238 |
taaccgcaacttttgtaaagataggggtccaaacgtgcaattaa |
14024195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 49
Target Start/End: Complemental strand, 18530873 - 18530830
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
18530873 |
gcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
18530830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 18621763 - 18621720
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
18621763 |
cgcaacttttagaaagataggggaccaaaagtgcaattaagcct |
18621720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 25250000 - 25249957
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
25250000 |
taaccgcaacttttgaaaagataggggtccaaaagtacaattaa |
25249957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 31947896 - 31947853
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31947896 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
31947853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 32498420 - 32498377
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
32498420 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
32498377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37205586 - 37205539
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
37205586 |
taaccgcaacttttgaaaagataggggttcaaaaatgcaattaagcct |
37205539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 39626013 - 39625970
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
39626013 |
taaccgcaacttttagaaagataggggttcaaaagtgcaattaa |
39625970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 39635563 - 39635520
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
39635563 |
taaccgcaacttttagaaagataggggttcaaaagtgcaattaa |
39635520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 42524752 - 42524709
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
42524752 |
cgcaacttttagaaagatagggatccaaaagtgcaattaagcct |
42524709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 42930885 - 42930928
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
42930885 |
taaccgcaacttttgaaaagataggggtcaaaaagtgcaattaa |
42930928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 44885950 - 44885907
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
44885950 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaa |
44885907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45516187 - 45516234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
45516187 |
taaccgcaacttttgaaaagataggagtccaaaaatgcaattaagcct |
45516234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 16531294 - 16531248
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| | |||||||||| |
|
|
| T |
16531294 |
taaccgcaacttttgaaaagataggggtccaaaaatacaattaagcc |
16531248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27339810 - 27339856
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
27339810 |
taaccgcaacttttaaaaagataggggtccaaaaatgcaattaagcc |
27339856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 28596197 - 28596243
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
28596197 |
taaccacaacttttagaaagatagggatccaaaagtgcaattaagcc |
28596243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 41574201 - 41574155
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
41574201 |
taaccacaacttttgaaaaaatagaggtccaaaagtacaattaagcc |
41574155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 9878746 - 9878787
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9878746 |
aacttttgaaaaaatagaggaccaaaagtgcaattaagcctt |
9878787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 13229362 - 13229321
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
13229362 |
cgcaacttttgaaaagatagagggcccaaagtgcaattaagc |
13229321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 26919989 - 26920030
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
26919989 |
caacttttgaaaagatagggggccaaaagtgcaattaagcct |
26920030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 33877763 - 33877812
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
33877763 |
taaccacaacttttgaaaagatagggggtccaaaagtgcaattaagcctt |
33877812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4167250 - 4167202
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
4167250 |
taaccacaacttttgaaaaaataggcgtccaaaagtgcaattaagcctt |
4167202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7150888 - 7150840
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
7150888 |
taactgcaacttttgaaaagataggggttcaaaaatgcaattaagcctt |
7150840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Original strand, 7891017 - 7891061
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaac |
92 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
7891017 |
ttgatgatattatgaggaccgaacttttgatgccattgtacaaac |
7891061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15188227 - 15188275
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
15188227 |
taaccacaacttttagaaggatagaggtccaaaagtacaattaaacctt |
15188275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 20283850 - 20283814
Alignment:
| Q |
13 |
ttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
20283850 |
ttggaaagataggggtccaaaagtgcaattaaacctt |
20283814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 21070478 - 21070442
Alignment:
| Q |
13 |
ttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21070478 |
ttggaaagataggggtccaaaagtgcaattaaacctt |
21070442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 31933946 - 31934006
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||| | |||||||||||||||| || |||| ||| ||| |||||||||||| |
|
|
| T |
31933946 |
ttgatgatactataatgactgaacttttgatgtcattgtataaagagtggggtgttactca |
31934006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32318552 - 32318504
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| || ||||||||||| |
|
|
| T |
32318552 |
taaccgcaacttttagaaagataggagtccaaaaatgaaattaagcctt |
32318504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 37277506 - 37277458
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||| |||||||||||| |
|
|
| T |
37277506 |
taaccgcaacttttaaaaaaataggggtccaaaagtacaattaagcctt |
37277458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 37277734 - 37277770
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
37277734 |
aacttttgaaaagataggggtccaaaagtgcaattaa |
37277770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 43643655 - 43643715
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| || |||||||| |||| || |||||||||||| | |||||||||| |
|
|
| T |
43643655 |
ttgatgatactatgaagattgaactttggatgtcattgtacaaacagtagagtgttactca |
43643715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 44807346 - 44807390
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
44807346 |
cgcaacttttgaaaagatagggggtcaaaagtgcaattaagcctt |
44807390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 45022606 - 45022646
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
45022606 |
acttttggaaagataggggtccaaaagggcaattaaacctt |
45022646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45106702 - 45106750
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||| |||| |
|
|
| T |
45106702 |
taaccgcaacttttaaaaagataggggttcaaaagtgcaattaaacctt |
45106750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 45326146 - 45326189
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
45326146 |
cgcaatttttggaaagatag-ggaccaaaagtgcaattaagcctt |
45326189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 215)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 37203189 - 37203126
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37203189 |
ttgatgatactatgaggactgaacttttgatgccactgtacaaacagtggggtgttactcacta |
37203126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42230079 - 42230031
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230079 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
42230031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 32508186 - 32508232
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32508186 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
32508232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 4015582 - 4015521
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
4015582 |
ttgatgatactatgaggactgaacttttgatgtcactctacaaacagttgggtgttactcac |
4015521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 11466946 - 11466885
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11466946 |
ttgatgatactatggggactaaacttttgatgccactgtacaaacagtggggtgttactcac |
11466885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2239497 - 2239545
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2239497 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
2239545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 17916350 - 17916398
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17916350 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
17916398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26494731 - 26494683
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26494731 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
26494683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27748290 - 27748242
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27748290 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
27748242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27766564 - 27766516
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27766564 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
27766516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 37182050 - 37182002
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37182050 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
37182002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42465737 - 42465689
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42465737 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
42465689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45743945 - 45743897
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45743945 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
45743897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45760278 - 45760230
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45760278 |
taaccgcaacttttggaaagatagaggtcaaaaagtgcaattaagcctt |
45760230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 47530607 - 47530655
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47530607 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
47530655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 52916905 - 52916857
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52916905 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
52916857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 53192160 - 53192112
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53192160 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
53192112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8313995 - 8313948
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8313995 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
8313948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10864161 - 10864114
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10864161 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
10864114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 12881281 - 12881234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12881281 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
12881234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 12881482 - 12881529
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12881482 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
12881529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 19391684 - 19391637
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19391684 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
19391637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 19391970 - 19392017
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19391970 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
19392017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 19914739 - 19914786
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19914739 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
19914786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20982526 - 20982573
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20982526 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
20982573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 21841978 - 21842033
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgtta |
56 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21841978 |
taaccgcaacttttgaaaagatagaggtctaaaagtgcaattaagccttgttgtta |
21842033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27748510 - 27748557
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27748510 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
27748557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27766784 - 27766831
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27766784 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
27766831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28964199 - 28964152
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28964199 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
28964152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 32204890 - 32204847
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32204890 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
32204847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 37157829 - 37157767
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
37157829 |
ttgatgatactatgatgactgaacttttgatgccactgtac-aacagtggggtgttactcacta |
37157767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42230298 - 42230345
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42230298 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
42230345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44177334 - 44177287
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44177334 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
44177287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44184018 - 44183971
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44184018 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
44183971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 44895915 - 44895962
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44895915 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
44895962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45744166 - 45744213
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45744166 |
taaccgcaacttttggaaagatagagatccaaaagtgcaattaagcct |
45744213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 47423395 - 47423442
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47423395 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
47423442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47943505 - 47943458
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47943505 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcct |
47943458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 49997923 - 49997970
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49997923 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcct |
49997970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 53532073 - 53532120
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53532073 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
53532120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3212419 - 3212465
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3212419 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
3212465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 22202530 - 22202484
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22202530 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
22202484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 25053851 - 25053897
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25053851 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
25053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27857402 - 27857448
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27857402 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
27857448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 44184238 - 44184284
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44184238 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
44184284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 47530385 - 47530339
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47530385 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
47530339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 53192380 - 53192426
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53192380 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
53192426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 2008055 - 2007994
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| | ||||| ||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2008055 |
ttgatgatgctatggggattgaacttttgatgccactgtacaaacagtggggtgttactcac |
2007994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 2711747 - 2711698
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2711747 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagccttg |
2711698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 11357418 - 11357483
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt-cgggtgttactcactat |
112 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
11357418 |
ttgatgatactatgatgactgaacttttgatgcaactgtacaaacagtgggggtgttactcactat |
11357483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 3362375 - 3362311
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
3362375 |
ttgatgataccatgaggagtgaacttttgatgccactgtacaaatagtgggatgttactcactat |
3362311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 3655256 - 3655316
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||||| || |||||||||||| |
|
|
| T |
3655256 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacggtggggtgttactca |
3655316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7858229 - 7858277
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
7858229 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagcctt |
7858277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 9153523 - 9153475
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9153523 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
9153475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11962992 - 11963040
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11962992 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
11963040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 31869463 - 31869507
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31869463 |
aaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
31869507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32205114 - 32205162
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32205114 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
32205162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32459050 - 32459098
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32459050 |
taaccgcaacttttggaaagatagagatccaaaaatgcaattaagcctt |
32459098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 33576676 - 33576724
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
33576676 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
33576724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 33621912 - 33621864
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
33621912 |
taaccgcaacttttgtaaagataggggtccaaaagtgcaattaagcctt |
33621864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40082457 - 40082505
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40082457 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
40082505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 41223559 - 41223511
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
41223559 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
41223511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 41722100 - 41722052
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41722100 |
taaccgcaacttttggaaatataggggtccaaaagtgcaattaagcctt |
41722052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 42506129 - 42506189
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||| ||||||| |
|
|
| T |
42506129 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtggggtattactca |
42506189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 48355063 - 48355003
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
48355063 |
ttgatgatactatgagaactgaacttttgatgccattgtacaaacaatggggtgttactca |
48355003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 51213035 - 51213095
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
51213035 |
ttgatgatactatgaggactcaacttttgatgccattgtacaaacagtggggtgttgctca |
51213095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 51843069 - 51843113
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51843069 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
51843113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 53531852 - 53531804
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
53531852 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
53531804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 54718115 - 54718163
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
54718115 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
54718163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 257703 - 257750
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
257703 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
257750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3384255 - 3384302
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
3384255 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcct |
3384302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 9633665 - 9633712
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9633665 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcct |
9633712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 14770689 - 14770736
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14770689 |
cgcaacttttggaaagatagagggccaaaagtgcaattaaaccttgat |
14770736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 19914522 - 19914475
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19914522 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
19914475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 21841773 - 21841726
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21841773 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
21841726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 25126265 - 25126312
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25126265 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
25126312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27984399 - 27984446
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
27984399 |
taaccgcaacttttggaaagataggggtccaaaagtgtaattaagcct |
27984446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 28964421 - 28964468
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28964421 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
28964468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 30200462 - 30200419
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30200462 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
30200419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 31117666 - 31117619
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31117666 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
31117619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 33252752 - 33252795
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33252752 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
33252795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 38511924 - 38511971
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38511924 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
38511971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 41281891 - 41281844
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41281891 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
41281844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42465937 - 42465984
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
42465937 |
taaccgcaacttttggaaagattgaggttcaaaagtgcaattaagcct |
42465984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 47943727 - 47943774
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
47943727 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
47943774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 51214426 - 51214473
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51214426 |
taaccgcaacttttaaaaagatagaggtccaaaagtgcaattaagcct |
51214473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 52917586 - 52917633
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
52917586 |
taaccgcaacttttggaaagataggggcccaaaagtgcaattaagcct |
52917633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 53191007 - 53190964
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53191007 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
53190964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 53422135 - 53422092
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53422135 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
53422092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2118981 - 2119027
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2118981 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
2119027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 5154048 - 5154094
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5154048 |
taaccgcaacttttggaaaaatagtggtccaaaagtgcaattaagcc |
5154094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 5577200 - 5577246
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5577200 |
taacctcaacttttggaaagataggggtccaaaagtgcaattaagcc |
5577246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 10864386 - 10864432
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10864386 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
10864432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 17483825 - 17483871
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17483825 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
17483871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 20982326 - 20982280
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
20982326 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
20982280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 41282114 - 41282160
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41282114 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
41282160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 45760500 - 45760546
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
45760500 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
45760546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 47423193 - 47423135
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgttacta |
59 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
47423193 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaaacctttatgttacta |
47423135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 49997701 - 49997655
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
49997701 |
taaccgcaacttttggaaaaataggggtccaaaagtgcaattaagcc |
49997655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 50033359 - 50033313
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50033359 |
taaccgtaacttttggaaagatagaggtctaaaagtgcaattaagcc |
50033313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 53191230 - 53191276
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
53191230 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcc |
53191276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 54717211 - 54717165
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
54717211 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcc |
54717165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 29099477 - 29099416
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| | |||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
29099477 |
ttgatgatactaaggggactgaactttagatgtcactgtacaaacagtggggtgttactcac |
29099416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 30761067 - 30761124
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgttact |
58 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| || ||||| |
|
|
| T |
30761067 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcctttattttact |
30761124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 34133057 - 34132996
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| || |||| ||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
34133057 |
ttgatgatattatggggactgaacttttgatgtcattgtacaaacagtggggtgttactcac |
34132996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 35844448 - 35844387
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
35844448 |
ttgatgatactatggggactaaacttttgatgtcactgtacaaacagtgaggtgttactcac |
35844387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 44186555 - 44186616
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||| |||||| ||||||||||||| |
|
|
| T |
44186555 |
ttgatgatactatggggactgaacttttgatgtcactgtataaacagcggggtgttactcac |
44186616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 45174627 - 45174566
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
45174627 |
ttgatgatactatggggactgaacttttgatgctactgtacaaacagtgaagtgttactcac |
45174566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 49859718 - 49859763
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
49859718 |
taaccgcaacttttgaaaagatagaggtccaaaagtacaattaagc |
49859763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 52613589 - 52613634
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
52613589 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagc |
52613634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2118759 - 2118711
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
2118759 |
taaccgcaacttttgaaaagataggggtctaaaagtgcaattaagcctt |
2118711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2239273 - 2239225
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
2239273 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
2239225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 4761703 - 4761763
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
4761703 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtgaagtgttactca |
4761763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 8727959 - 8727915
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
8727959 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
8727915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9079846 - 9079802
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9079846 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
9079802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 27719953 - 27719997
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
27719953 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
27719997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 28097463 - 28097415
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
28097463 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
28097415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28097691 - 28097739
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
28097691 |
taaccgcaacttttgaaaagataggggtccaaaagtggaattaagcctt |
28097739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32507973 - 32507925
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
32507973 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaagcctt |
32507925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32593836 - 32593788
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
32593836 |
taaccgcaactttttaaaagatagaggtccaaaagtgcaattaaacctt |
32593788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 33576453 - 33576405
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
33576453 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaaacctt |
33576405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36017028 - 36017076
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
36017028 |
taaccgcaacttttggaaagataggggtctaaaagtgaaattaagcctt |
36017076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36373812 - 36373860
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
36373812 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcctt |
36373860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 39905774 - 39905730
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
39905774 |
taaccgcaacttttgaaaagatagaggtcaaaaagtgcaattaag |
39905730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 44701860 - 44701816
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
44701860 |
aaccgcaacttttggaaagatagggggccaaaagtgcaattaagc |
44701816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 46297816 - 46297880
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||| | ||||||||||||||| |||| |||||||||||| | |||||||||||||| |
|
|
| T |
46297816 |
ttgatgatactacggggactgaacttttgacgccattgtacaaacagtggtgtgttactcactat |
46297880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 47722195 - 47722147
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
47722195 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaaacctt |
47722147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 50033508 - 50033556
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
50033508 |
taaccgcaacctttgaaaagataggggtccaaaagtgcaattaagcctt |
50033556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 53764617 - 53764573
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
53764617 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcctt |
53764573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 2205795 - 2205838
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2205795 |
taaccgcaatttttggaaagataggggtccaaaagtgcaattaa |
2205838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 5576979 - 5576928
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
5576979 |
taaccgcaacttttaaaaagataggggtccaaaagtacaattaagccttgat |
5576928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 9630814 - 9630767
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
9630814 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
9630767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11961911 - 11961864
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
11961911 |
taaccgcaacttttgaaaagttaggggtccaaaagtgcaattaagcct |
11961864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 14904480 - 14904441
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14904480 |
acttttggaaagataggggtccaaaagtgcaattaagcct |
14904441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 20373350 - 20373409
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
20373350 |
ttgatgataccatgagaactgaacttttgatgtcattgtacaaacagtggggtgttactc |
20373409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 22451090 - 22451027
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
22451090 |
ttgatgatactatggggactgaacttttgatgccaccatacaaacagtgaggtgctactcacta |
22451027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25782699 - 25782652
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
25782699 |
taaccgcaacttttggaaaaataggggtcaaaaagtgcaattaagcct |
25782652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 27448860 - 27448813
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
27448860 |
taaccgcaacttttggaaagataggggttcaaaagtacaattaagcct |
27448813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29168775 - 29168732
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
29168775 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
29168732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29168995 - 29169042
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
29168995 |
taaccgcaacttttgaaaagatagatgtctaaaagtgcaattaagcct |
29169042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30200681 - 30200728
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30200681 |
taaccgcaacttttggaaagataggagtctaaaagtgcaattaagcct |
30200728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 39282764 - 39282713
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
39282764 |
tatgagaactgaacttttgatgccactgtataaacagtggggtattactcac |
39282713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 40082258 - 40082211
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40082258 |
taaccgcaacttttgaaaagataggtgtccaaaagtgcaattaagcct |
40082211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 44624493 - 44624540
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44624493 |
taaccgtaacttttgaaaagataggggtccaaaagtgcaattaagcct |
44624540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 46934259 - 46934302
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
46934259 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcct |
46934302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 51336936 - 51336889
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
51336936 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcct |
51336889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 787145 - 787099
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
787145 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcc |
787099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 17483607 - 17483561
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17483607 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcc |
17483561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 21193713 - 21193667
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
21193713 |
ggactgaacttttgatgtcactctacaaacagtggggtgttactcac |
21193667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 27984185 - 27984139
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27984185 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcc |
27984139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 33933635 - 33933681
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
33933635 |
taaccgcaacttttggaaagatagggggccaaaattgcaattaagcc |
33933681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 36441528 - 36441482
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
36441528 |
taaccgcaacttttagaaagataggagtccaaaagtgcaattaagcc |
36441482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 38511705 - 38511659
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
38511705 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcc |
38511659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 51213349 - 51213307
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
51213349 |
cgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
51213307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 51842847 - 51842801
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
51842847 |
taaccgcaacttttgaaaagatagagatctaaaagtgcaattaagcc |
51842801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 3212199 - 3212158
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
3212199 |
taaccgcaacttttagaaagataggggtccaaaagtgcaatt |
3212158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 7327536 - 7327597
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||| | | | ||||||||||| |
|
|
| T |
7327536 |
ttgatgatactatggggactgaacttttgatgtcactgtacaaataatggagtgttactcac |
7327597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 8728186 - 8728227
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8728186 |
aacttttggaaagataggggtccaaaagtgcaattaaacctt |
8728227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 9080073 - 9080114
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
9080073 |
aacttttggaaagataggggtccaaaagtgcaattaaacctt |
9080114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 67 - 112
Target Start/End: Original strand, 22446138 - 22446182
Alignment:
| Q |
67 |
tgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
22446138 |
tgaacttttgatgccactgtacaaa-agtggggtgttactcactat |
22446182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 26941325 - 26941374
Alignment:
| Q |
59 |
atgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
26941325 |
atgaggactgaacttttgatgtcattatacaaacagtggggtgttactca |
26941374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 107
Target Start/End: Complemental strand, 40936111 - 40936054
Alignment:
| Q |
50 |
gatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| ||||| | |||||||||| |
|
|
| T |
40936111 |
gatgatactatgaggactgaacttttgatgtcactgtataaacaatgaggtgttactc |
40936054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 44177552 - 44177597
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44177552 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagc |
44177597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 52040976 - 52041021
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
52040976 |
ttgatgatactatgatgactgaacttttgatgccactatacaaaca |
52041021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 787367 - 787411
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
787367 |
taaccgcaacttttggaaaaatagggatccaaaagtgcaattaag |
787411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5153827 - 5153779
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
5153827 |
taaccgtaacttttaaaaagatagaggtccaaaagtgcaattaaacctt |
5153779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 7858024 - 7857980
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
7858024 |
ccgcaacttttgaaaagataggggtccaaaagtacaattaagcct |
7857980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8315348 - 8315396
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||| |||| ||| |||||||||||||||||||| |
|
|
| T |
8315348 |
taaccgcaacttttgaaaaaataggggttcaaaagtgcaattaagcctt |
8315396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25782920 - 25782968
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
25782920 |
taaccgcaacttttggaaagataagtgtctaaaagtgcaattaagcctt |
25782968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31869241 - 31869194
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
31869241 |
taaccgcaacttttagaaaaatag-ggtccaaaagtgcaattaagcctt |
31869194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 33622133 - 33622177
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
33622133 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaag |
33622177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 40552313 - 40552373
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| || |||||||||||||||||||||| || ||||||||| || | |||||||||| |
|
|
| T |
40552313 |
ttgatgatattatgaggactgaacttttgatgtcattgtacaaacggtggagtgttactca |
40552373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 47481644 - 47481584
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||| || ||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
47481644 |
ttgatgatactatgagggctaaacttttgatgtcattctacaaacagtggggtgttactca |
47481584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 2205583 - 2205540
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2205583 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaa |
2205540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7818979 - 7818936
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
7818979 |
taaccgcaacttttagaaagataggggttcaaaagtgcaattaa |
7818936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 49
Target Start/End: Original strand, 9169273 - 9169316
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
9169273 |
gcaacttttggaaagattgagggcaaaaagtgcaattaagcctt |
9169316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10439332 - 10439285
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
10439332 |
taaccacaacttttaaaaaaatagaggtccaaaagtgcaattaagcct |
10439285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14133686 - 14133639
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
14133686 |
taaccgcaagttttggaaagataggggtcaaaaagtgcaactaagcct |
14133639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 14133888 - 14133934
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14133888 |
taaccacaacttttggaaagataggggtccaaaagtg-aattaagcct |
14133934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 21690136 - 21690183
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21690136 |
taaccgtaacttttggaaagataggggggcaaaagtgcaattaagcct |
21690183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24636396 - 24636349
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
24636396 |
taaccacaacttttgaaaagataggggtccaaaagtacaattaagcct |
24636349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 24708171 - 24708231
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcact |
110 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
24708171 |
ttgatgatactatgaagactgaacttttgatgtcactgtac--acagtgaggtgttactcact |
24708231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 32458825 - 32458782
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32458825 |
taaccgcaacttttggaaagataggagtccaaaaatgcaattaa |
32458782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 32594036 - 32594079
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
32594036 |
taaccacaacttttgaaaagatagaggtccaaaagtacaattaa |
32594079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 33252526 - 33252483
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
33252526 |
cgcaacttttagaaagataggggtccaaaagtacaattaagcct |
33252483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 44895691 - 44895648
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44895691 |
cgcaacttttaaaaagataggggtccaaaagtgcaattaagcct |
44895648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 46934081 - 46934038
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
46934081 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
46934038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 49859571 - 49859528
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
49859571 |
taaccgcaacttttagaaagataggagtccaaaagtgcaattaa |
49859528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 53176176 - 53176129
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
53176176 |
ttgatgatactatgaggactgaacttttgatgttattgtacaaacagt |
53176129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14015410 - 14015456
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| || ||||||| |
|
|
| T |
14015410 |
taaccgcaacttttgaaaagataggggtccaaaagtacacttaagcc |
14015456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 41722251 - 41722297
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
41722251 |
taaccacaacttttgaaaagataggggttcaaaagtgcaattaagcc |
41722297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 43678969 - 43679015
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
43678969 |
taaccgcaacttttgaaaatataggtgtccaaaagtgcaattaagcc |
43679015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 45125137 - 45125095
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
45125137 |
cgcaacttttgaaaagatagagggctaaaagtgcaattaagcc |
45125095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 9169012 - 9168971
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
9169012 |
cgcaacttttgaaaagattgagggccaaaagtgcaattaagc |
9168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 9792967 - 9792918
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||||||||| ||||| || ||| ||||||||||||||| ||||| |
|
|
| T |
9792967 |
taaccgcaacttttgaaaagaaaggggttcaaaagtgcaattaaaccttg |
9792918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 21689976 - 21689943
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaa |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
21689976 |
taaccgcaacttttggaaagataggggtccaaaa |
21689943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 27480433 - 27480478
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
27480433 |
ttgatgatactatggggactgaacttttgatgtcaccgtacaaaca |
27480478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 36441591 - 36441636
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| | | ||||||||||||||||| |
|
|
| T |
36441591 |
taaccgcaacttttgaaaagatagggattcaaaagtgcaattaagc |
36441636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 43348364 - 43348319
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
43348364 |
gactgaacttttgatgccactaaacaaacagtggggtgttgctcac |
43348319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 53229206 - 53229251
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
53229206 |
ttgatgatattatgatgactgaacttttgatgcaactgtacaaaca |
53229251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 54716516 - 54716475
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
54716516 |
caacttttgaaaagatagggggccaaaagtgcaattaagcct |
54716475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 9153744 - 9153788
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
9153744 |
taaccgtaacttttagaaagataggagtccaaaagtgcaattaag |
9153788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 9793186 - 9793234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
9793186 |
taaccgcaatttttgaaaagataagagtccaaaagtgcaattaagcctt |
9793234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 14004108 - 14004148
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
14004108 |
aacttttgaaaagatagggatccaaaagtgcaattaagcct |
14004148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 14015210 - 14015178
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaa |
33 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
14015210 |
taaccgcaacttttggaaagataggggtccaaa |
14015178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 21009856 - 21009916
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| || ||||||| |||||||||||||| || | |||||| ||| |||||||||||| |
|
|
| T |
21009856 |
ttgatgataatatgagggctgaacttttgatgtcattctacaaatagtggggtgttactca |
21009916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 23086168 - 23086124
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
23086168 |
taactgcaacttttggaaagataggagtccaaaaatgcaattaag |
23086124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 26012935 - 26012983
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||||||||| |||| |
|
|
| T |
26012935 |
taaccgcaacttttgaaaagataggagtccaaaaatgcaattaaacctt |
26012983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 31577687 - 31577731
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
31577687 |
taaccacaacttttaaaaagataggggtccaaaagtgcaattaag |
31577731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 39589047 - 39589007
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
39589047 |
acttttggaaagataggggtccaaaaatgcaatttagcctt |
39589007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 39708048 - 39708008
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
39708048 |
acttttggaaagataggggtcgaaaagtgcaattaaacctt |
39708008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 40410145 - 40410189
Alignment:
| Q |
5 |
cgcaacttttgga-aagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
40410145 |
cgcaacttttggacaagatagggggccaaaagtgcaattaagcct |
40410189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 41223780 - 41223824
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41223780 |
taaccacaacttttaaaaagataggggtccaaaagtgcaattaag |
41223824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 53422344 - 53422392
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||| ||||||| |||||| |||| |
|
|
| T |
53422344 |
taaccgcaacttttagaaagataggggtctaaaagtgtaattaaacctt |
53422392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 93
Target Start/End: Original strand, 53811739 - 53811767
Alignment:
| Q |
65 |
actgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53811739 |
actgaacttttgatgccactgtacaaaca |
53811767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 206)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 5112357 - 5112421
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5112357 |
ttgatgatactatggggactgaacttttgatgccactgtacaaacagtggggtgttactcactat |
5112421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2710386 - 2710338
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2710386 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
2710338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 3223551 - 3223599
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3223551 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
3223599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4125490 - 4125442
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4125490 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
4125442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5088339 - 5088387
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5088339 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
5088387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 16521200 - 16521152
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16521200 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
16521152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16666840 - 16666888
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16666840 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
16666888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21583369 - 21583321
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21583369 |
taaccgcaacttttggaaagatagaggtcccaaagtgcaattaagcctt |
21583321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 24886235 - 24886175
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
24886235 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtggggtgttactca |
24886175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40768155 - 40768203
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40768155 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
40768203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 699281 - 699218
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || ||||| |||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
699281 |
ttgatgatattatgatgactgaacttttgatgtcactgtacaaacagtggggtgttactcacta |
699218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3728330 - 3728283
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3728330 |
taaccgcaacttttggaaagatagaggtccaaaagtacaattaagcct |
3728283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 9072014 - 9071967
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9072014 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
9071967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 15526750 - 15526703
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15526750 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
15526703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22925745 - 22925698
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22925745 |
taaccgcaacttttggaaagatagaggttcaaaagtgcaattaagcct |
22925698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 27264155 - 27264108
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27264155 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
27264108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28394979 - 28394932
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28394979 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
28394932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29401356 - 29401403
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29401356 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
29401403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30894171 - 30894124
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30894171 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
30894124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 33908364 - 33908301
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||| | ||| ||||||||| |
|
|
| T |
33908364 |
ttgatgatactatgaggactgaacttttgatgccaccgtacaaacagtggagtgctactcacta |
33908301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 35306756 - 35306709
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35306756 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
35306709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 40297711 - 40297664
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40297711 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
40297664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43586053 - 43586100
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43586053 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
43586100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 223161 - 223207
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
223161 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
223207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 23263412 - 23263458
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23263412 |
taaccgcaactgttggaaagatagaggtccaaaagtgcaattaagcc |
23263458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 7693361 - 7693300
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
7693361 |
ttgatgatactaagaggattgaacttttgatgccactgtacaaacagtgggatgttactcac |
7693300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 22773852 - 22773897
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22773852 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagc |
22773897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 25668780 - 25668719
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
25668780 |
ttgatgatactaaggggactgaacttttgatgccactgttcaaacagtggggtgttactcac |
25668719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 31172831 - 31172876
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31172831 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
31172876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 41880304 - 41880349
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41880304 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
41880349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 1429189 - 1429253
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
1429189 |
ttgatgatactatggagactgaatttttgatgccagtgtacaaacagtggggtgttactcactat |
1429253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2710604 - 2710652
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2710604 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
2710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4096718 - 4096766
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
4096718 |
taaccgcaacttttgaaaagataaaggtccaaaagtgcaattaagcctt |
4096766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 9072216 - 9072264
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9072216 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcctt |
9072264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12049165 - 12049117
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12049165 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcctt |
12049117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16079445 - 16079493
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16079445 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcctt |
16079493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 16597087 - 16597039
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
16597087 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaaacctt |
16597039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 20974506 - 20974462
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20974506 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
20974462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23263191 - 23263143
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23263191 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
23263143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 26036483 - 26036531
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26036483 |
taaccgcaacttttggaaagataggggtccaaaagtgcaatttagcctt |
26036531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 27330435 - 27330375
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
27330435 |
ttgatgatactatgaagactgaacttttgatgccattgtacaaacagtaaggtgttactca |
27330375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 28251444 - 28251400
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28251444 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
28251400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28251645 - 28251693
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28251645 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
28251693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 28395200 - 28395244
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28395200 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
28395244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 28620085 - 28620037
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28620085 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcctt |
28620037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34082368 - 34082416
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34082368 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
34082416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34606637 - 34606685
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34606637 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
34606685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35306969 - 35307017
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35306969 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
35307017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39529032 - 39529080
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
39529032 |
taaccgcaacttttggaaagataggggtccaaaagtgtaattaagcctt |
39529080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40687712 - 40687664
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
40687712 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
40687664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 41032453 - 41032501
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
41032453 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagcctt |
41032501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 41140381 - 41140429
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
41140381 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
41140429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1055635 - 1055682
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1055635 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcct |
1055682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3020861 - 3020908
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3020861 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
3020908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4125711 - 4125758
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4125711 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcct |
4125758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5088120 - 5088073
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5088120 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
5088073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 5891747 - 5891790
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5891747 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
5891790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 10029339 - 10029390
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
10029339 |
taaccgcaacttttcgaaagataggggttcaaaagtgcaattaagccttgat |
10029390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11480082 - 11480035
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11480082 |
taacctcaacttttggaaagataggggtccaaaagtgcaattaagcct |
11480035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 12049384 - 12049431
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12049384 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
12049431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13356603 - 13356556
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
13356603 |
taaccgcaacttttggaaagataggggtccaaaagtgcaatcaagcct |
13356556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13960957 - 13961004
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
13960957 |
taaccgcaacttttgaaaagatagaggtccaaaagtacaattaagcct |
13961004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 18266398 - 18266351
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18266398 |
taaccgcaacctttggaaagataggggtccaaaagtgcaattaagcct |
18266351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22052485 - 22052438
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22052485 |
taaccgcaacttttggaaagatagggggccaaaagtgcaattaagcct |
22052438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 22052706 - 22052753
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22052706 |
taaccgcaacttttggaaagataggggtccaaaattgcaattaagcct |
22052753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 23103969 - 23103922
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
23103969 |
taaccgcaacttttggaaagataggggtccaaaagtgtaattaagcct |
23103922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 25566809 - 25566852
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25566809 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
25566852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 27264372 - 27264415
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27264372 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
27264415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29183179 - 29183136
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29183179 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
29183136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31456128 - 31456175
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31456128 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
31456175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 31786690 - 31786737
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31786690 |
ttgatgatactatgaggattgaacttttgatgccactgtacaaacagt |
31786737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32556012 - 32556059
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32556012 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaagcct |
32556059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 34734340 - 34734387
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34734340 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
34734387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8340005 - 8339959
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8340005 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
8339959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 56 - 106
Target Start/End: Complemental strand, 19119982 - 19119932
Alignment:
| Q |
56 |
actatgaggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
19119982 |
actatggggactgaacttttgatgtcactgtacaaacagtggggtgttact |
19119932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21583590 - 21583636
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21583590 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcc |
21583636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 26323642 - 26323688
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26323642 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
26323688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 28703916 - 28703962
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28703916 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattcagcc |
28703962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 34169055 - 34169101
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34169055 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
34169101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 36860547 - 36860493
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
36860547 |
tactatggggactgaacttttgatgtcattgtacaaacagtggggtgttactcac |
36860493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 36866878 - 36866832
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36866878 |
ggactgaacttttgatgccattgtacaaacagtggggtgttactcac |
36866832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 1050082 - 1050041
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1050082 |
taaccgcaacttttggaaagataggggtccaaaagtgcaatt |
1050041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 2546417 - 2546372
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2546417 |
taaccgtaacttttggaaagataggggtccaaaagtgcaattaagc |
2546372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 3728531 - 3728576
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3728531 |
taaccgtaacttttggaaagatagagatccaaaagtgcaattaagc |
3728576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 5837686 - 5837625
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
5837686 |
ttgatgatactatggagactgaaattttgatgtcactgtacaaacagtggggtgttactcac |
5837625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 9200364 - 9200303
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||| |||||||||||| || ||||||||||||| |
|
|
| T |
9200364 |
ttgatgatactaagaggactaaacttttgatgtcactgtacaaactgtggggtgttactcac |
9200303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 19849812 - 19849857
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19849812 |
accgcaacttttggaaatataggggtccaaaagtgcaattaagcct |
19849857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 22627025 - 22626988
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22627025 |
caacttttggaaagatagaggtccaaaagtgcaattaa |
22626988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 23502400 - 23502441
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23502400 |
gcaacttttggaaagataggggtccaaaagtgcaattaagcc |
23502441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 30969368 - 30969429
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||| ||| ||| ||||||||||||| |
|
|
| T |
30969368 |
ttgatgatactatgaggactgaacttttgatgtcattgtataaatagtggggtgttactcac |
30969429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 5830032 - 5829972
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| || ||||||||| || |||||||||||| |
|
|
| T |
5830032 |
ttgatgatactatgaggactaaacttttgatgtcattgtacaaacggtagggtgttactca |
5829972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 59 - 111
Target Start/End: Complemental strand, 8437086 - 8437034
Alignment:
| Q |
59 |
atgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | || |||||||||||| |
|
|
| T |
8437086 |
atgaggactgaacttttgatgtcactgtacaaacaatgggatgttactcacta |
8437034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 11898133 - 11898073
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
11898133 |
ttgatgatactatgaggactaaacttttgatgtcactgtacaactagtagggtgttactca |
11898073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13170147 - 13170195
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13170147 |
taaccgcaacttttagaaagataagggtccaaaagtgcaattaagcctt |
13170195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13765528 - 13765576
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13765528 |
taaccgcaattttttgaaagataggggtccaaaagtgcaattaagcctt |
13765576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 14647742 - 14647694
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
14647742 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcctt |
14647694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15526936 - 15526984
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
15526936 |
taaccgcaacttttggaaagatataggtccaaaaatccaattaagcctt |
15526984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15738340 - 15738388
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
15738340 |
taaccgcaacttttgaaaagatatgggtccaaaagtgcaattaagcctt |
15738388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 15992584 - 15992636
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggt |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
15992584 |
ttgatgatactatgaagactgaacttttgatgtcactgtacaaacagtggggt |
15992636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16597307 - 16597355
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
16597307 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
16597355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20465549 - 20465501
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20465549 |
taactgcaacttttggaaagataggggtccaaaagtgtaattaagcctt |
20465501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 22255313 - 22255253
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| || |||||| |||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
22255313 |
ttgatgataatatgagaactgaacttttgatgccattgtacaaacggtggggtgttactca |
22255253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26151840 - 26151792
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
26151840 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaaacctt |
26151792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 26268205 - 26268145
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
26268205 |
ttgatgatactatgtggactaaacttttgatgtcaccgtacaaacagtggggtgttactca |
26268145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28736707 - 28736755
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
28736707 |
taaccgcaacttttgaaaagataggggtctaaaagtgcaattaagcctt |
28736755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 35826528 - 35826572
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35826528 |
tgatgatactatgaggactgaacttttgatgtcactgtacaaaca |
35826572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 40767934 - 40767890
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
40767934 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
40767890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42947447 - 42947399
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
42947447 |
taaccgcaacttttagaaagataggagtccaaaagtgcaattaagcctt |
42947399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 104
Target Start/End: Original strand, 43308696 - 43308751
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtta |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
43308696 |
ttgatgatactatgaggactgaacttttgatgccattgtacgaacagt-gggtgtta |
43308751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 43585851 - 43585803
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
43585851 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattatgcctt |
43585803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 1055417 - 1055374
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
1055417 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
1055374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3020640 - 3020593
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
3020640 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaagcct |
3020593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7219544 - 7219497
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
7219544 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaagcct |
7219497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7219764 - 7219811
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7219764 |
taaccgcaacttttggaaagataagagtccaaaagtgcaattaagcct |
7219811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7623567 - 7623525
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7623567 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaa |
7623525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 9560101 - 9560148
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
9560101 |
taaccgcaacttttagaaagataggggtccaaaaatgcaattaagcct |
9560148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13356816 - 13356863
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13356816 |
taaccgcaacttttggaaagataggggatccaaaagtgcaattaagcc |
13356863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13765305 - 13765258
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
13765305 |
taaccgcaacttttgaaaagataggggtcgaaaagtgcaattaagcct |
13765258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 13960734 - 13960691
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
13960734 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaa |
13960691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16666119 - 16666072
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
16666119 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
16666072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19849598 - 19849555
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
19849598 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaa |
19849555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 23116266 - 23116329
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
23116266 |
ttgatgatactatgtaaactgaacttttgattccactgtacaaacagtggggtgctactcacta |
23116329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25631132 - 25631085
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25631132 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
25631085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28736486 - 28736443
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
28736486 |
taaccgcaacttttggaaaaataggggtccaaaagtgcaattaa |
28736443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 31455928 - 31455877
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |||| |
|
|
| T |
31455928 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagccatgat |
31455877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 33825646 - 33825603
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
33825646 |
taaccgcaacttttggaaagataggggtccaaacgtgcaattaa |
33825603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 34168833 - 34168790
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34168833 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaa |
34168790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35055823 - 35055776
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35055823 |
taaccgcaacttttggaaagataggggatccaaaagtgcaattaagcc |
35055776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 37333801 - 37333848
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
37333801 |
aaccgcaacttttagaaagataagggtccaaaagtgcaattaagcctt |
37333848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 40133506 - 40133455
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
40133506 |
tatggggactgaacttttgatgccattgtacaaatagtggggtgttactcac |
40133455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 40297933 - 40297976
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
40297933 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaa |
40297976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 40687936 - 40687983
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40687936 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
40687983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8986656 - 8986610
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8986656 |
taaccgtaacttttggaaagataggagtccaaaagtgcaattaagcc |
8986610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 15738120 - 15738074
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
15738120 |
taaccgcaacttttgaaaagataggggtcaaaaagtgcaattaagcc |
15738074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Original strand, 21088817 - 21088871
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||| |||||| |||||| |
|
|
| T |
21088817 |
tactatggggactgaacttttgatgtcattgtacaaacagtggggtgtcactcac |
21088871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 48
Target Start/End: Complemental strand, 34606418 - 34606372
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
34606418 |
aaccgcaacttttggaaagataggggtttaaaagtgcaattaagcct |
34606372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 39572943 - 39572889
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| ||||||||| | ||||||||||| |
|
|
| T |
39572943 |
tactatgagaactgaacttttgatgtcactgcacaaacagtggagtgttactcac |
39572889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 42739854 - 42739900
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42739854 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcc |
42739900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 6815703 - 6815744
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6815703 |
aacttttgaaaagatagagggccaaaagtgcaattaagcctt |
6815744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 9559900 - 9559859
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
9559900 |
taaccgcaacttttgaaaagatagagatccaaaagtgcaatt |
9559859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16860073 - 16860118
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
16860073 |
taaccgcaacttttagaaaaataggggtccaaaagtgcaattaagc |
16860118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 23500012 - 23499971
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
23500012 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaatt |
23499971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 23954833 - 23954898
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccact-gtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
23954833 |
ttgatgatactatggaaactgaacttttgatgccactagtaaaaacagtggggtgttactcactat |
23954898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 111
Target Start/End: Original strand, 35511531 - 35511584
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| | ||||||||||||| |
|
|
| T |
35511531 |
tatgatgactgaacttttgatgtcactttacaaacagtggagtgttactcacta |
35511584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 37060170 - 37060211
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
37060170 |
gcaacttttggaaagatagggggccaaaagtgcaattaagcc |
37060211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2546639 - 2546687
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
2546639 |
taactgcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
2546687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 4146411 - 4146451
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
4146411 |
caacttttggaaagatagggggccaaaagtgcaattaagcc |
4146451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 6824523 - 6824586
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaac--ttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
6824523 |
ttgatgatactatgaagactgaacacttttgatgtcactgtacaaacagtggagtgttactcac |
6824586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7623787 - 7623835
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||| |||| |
|
|
| T |
7623787 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaaacctt |
7623835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 8340231 - 8340275
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
8340231 |
cgcaacttttgaaaagataggggtccaaaagtggaattaagcctt |
8340275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 10029120 - 10029072
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
10029120 |
taaccgcaacttttggaaagataggggtccaaaaaagtaattaagcctt |
10029072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 12610547 - 12610587
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
12610547 |
caacttttgaaaagatagagggccaaaagtgcaattaagcc |
12610587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 14919572 - 14919632
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || | || ||||||| ||||||||||| |
|
|
| T |
14919572 |
ttgatgatactatgaggactgaacttttgatgtcattatataaacagtgaggtgttactca |
14919632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 15221489 - 15221529
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15221489 |
acttttggaaagatatgggtccaaaagtgcaattaagcctt |
15221529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 23104174 - 23104222
Alignment:
| Q |
1 |
taaccgcaacttttggaaa-gatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
23104174 |
taaccgcaacttttggaaaagataagggtccaaaagtgcaattaagcct |
23104222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23695572 - 23695524
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
23695572 |
taaccgcaactttgggaaaaatatgggtccaaaagtgcaattaagcctt |
23695524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25631348 - 25631396
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||||||||| |||| |
|
|
| T |
25631348 |
taaccgcaacttttagaaaaatagagatccaaaagtgcaattaaacctt |
25631396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 29401136 - 29401092
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
29401136 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaag |
29401092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29559820 - 29559772
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29559820 |
taaccgcaacttttgaaaagataggaatccaaaagtgcaattaagcctt |
29559772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 32780057 - 32780014
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32780057 |
accgcaacttttggaaagatagaggt---aaagtgcaattaagcctt |
32780014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34734120 - 34734072
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
34734120 |
taaccgcaatttttggaaaaatagagatccaaaagtgcaattaaacctt |
34734072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 38528281 - 38528340
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||| ||||| | |||||||||||| |
|
|
| T |
38528281 |
ttgatgatactatgag-actgaacttttgatgtcactgtataaacaatggggtgttactca |
38528340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 931893 - 931846
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||| ||||||||||| |
|
|
| T |
931893 |
taaccgcaacttttgaaaagatagggatccaaaagtacaattaagcct |
931846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3223482 - 3223435
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| ||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
3223482 |
taaccgcaatttttgaatagataggggtccaaaagtgcaattaagcct |
3223435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 4096494 - 4096455
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
4096494 |
cgcaacttttagaaagataggggtccaaaagtgcaattaa |
4096455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 7208908 - 7208966
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
7208908 |
ttgatgatacta-gaggactgaacttttgatgtcaatgtacaaacggtagggtgttactc |
7208966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 8755059 - 8755016
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
8755059 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaa |
8755016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 49
Target Start/End: Original strand, 14514956 - 14514999
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
14514956 |
gcaacttttggaaagatagggggccaaaagtgcaattaaacctt |
14514999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20974676 - 20974723
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
20974676 |
taaccacaacttttgaaaagataggggtccaaaagtacaattaagcct |
20974723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 21347699 - 21347742
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
21347699 |
taaccgtaacttttgaaaagataggggtccaaaagtgcaattaa |
21347742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 48
Target Start/End: Original strand, 24396090 - 24396121
Alignment:
| Q |
17 |
aaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24396090 |
aaagatagaggtccaaaagtgcaattaagcct |
24396121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 26036281 - 26036234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26036281 |
taaccacaacttttgaaaagatatgggtccaaaagtgcaattaagcct |
26036234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 26152059 - 26152106
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
26152059 |
taaccgcaacttttggaaagatatgggtctaaaagtacaattaagcct |
26152106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 27318531 - 27318594
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||| |||| ||| ||||||||||| || |||||||||||| | ||||||||||||| |
|
|
| T |
27318531 |
ttgatgatactgtgagaactaaacttttgatgtcattgtacaaacagtggtgtgttactcacta |
27318594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29391281 - 29391328
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29391281 |
taaccgcaacttttggaaagataagagtctaaaagtgcaattaagcct |
29391328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 33203984 - 33203941
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
33203984 |
taaccgcaacttttgaaaagataggggtccaaaattgcaattaa |
33203941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 34082145 - 34082102
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
34082145 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaa |
34082102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 35678134 - 35678095
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35678134 |
cgcaacttttggaaagataggggtccaaaaatgcaattaa |
35678095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 38466015 - 38465972
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
38466015 |
taaccgcaacttttagaaagataggggtccaaaaatgcaattaa |
38465972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 39049059 - 39049016
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
39049059 |
cgcaacttttgaaaagatagagggccaaaactgcaattaagcct |
39049016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 42779435 - 42779478
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
42779435 |
taaccacaatttttggaaagatagaggtccaaaagtgcgattaa |
42779478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39236 - 39282
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||| |||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
39236 |
taactgcaacttttgaaaagatagggatccaaaagtgcaattaagcc |
39282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 6815542 - 6815500
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
6815542 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
6815500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 8741930 - 8741992
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt-cgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
8741930 |
ttgatgatactatggagactgaacttttgatgccattgtacaaacaatgggggtgttactcac |
8741992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 112
Target Start/End: Complemental strand, 12910479 - 12910417
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgcc-----actgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| ||||||||| |||||| |
|
|
| T |
12910479 |
tactatgaggactgaacttttgatgtcactgtactgtacaaacagtggggtgttacgcactat |
12910417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14647955 - 14648001
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
14647955 |
taaccgcgacttttgaaaagataggggtccaaaagtacaattaagcc |
14648001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 17235277 - 17235319
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
17235277 |
gcaacttttgaaaagataggggaccaaaagtgcaattaagcct |
17235319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 22627251 - 22627297
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||| ||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
22627251 |
aaccgcaaattttgaaaagatagggatccaaaagtgcaattaagcct |
22627297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 110
Target Start/End: Complemental strand, 22980924 - 22980862
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcact |
110 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| || || |||||||| |||| ||||||||| |
|
|
| T |
22980924 |
ttgatgatactatggggactgaacttttgatgtcattgctcaaacagtggggtattactcact |
22980862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 109
Target Start/End: Original strand, 28416590 - 28416632
Alignment:
| Q |
67 |
tgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
28416590 |
tgaacttttgattccactgtacaaacagtgggatgttactcac |
28416632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 32555810 - 32555764
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
32555810 |
taaccgcaacttttaaaaagataggggtccaaaaatgcaattaagcc |
32555764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 32563265 - 32563219
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| | ||||||||||| |
|
|
| T |
32563265 |
ggactgaacttttgatgtcactgtacagacagtggagtgttactcac |
32563219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39528812 - 39528766
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
39528812 |
taaccgcaacttttaaaaagataggggttcaaaagtgcaattaagcc |
39528766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 8986888 - 8986925
Alignment:
| Q |
12 |
tttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8986888 |
tttgaaaagataggggtccaaaagtgcaattaagcctt |
8986925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 3738503 - 3738551
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||| |||| |
|
|
| T |
3738503 |
taaccgcaacttttaaaaagatagaggtccaaaaatacaattaatcctt |
3738551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 11709421 - 11709453
Alignment:
| Q |
16 |
gaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
11709421 |
gaaagataggggtccaaaagtgcaattaagcct |
11709453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 12610286 - 12610242
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
12610286 |
cgcaacttttaaaaagatagggggccaaaagtgcaattaagcctt |
12610242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 16329846 - 16329890
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| ||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
16329846 |
taaccacaacttttgaaaagatagggatccaaaagtgcaattaag |
16329890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 16860004 - 16859956
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
16860004 |
taaccacaacttttaaaaagataggggtccaaaagtgcaattaaacctt |
16859956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 17235178 - 17235134
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || |||||||| |||||||||||| |
|
|
| T |
17235178 |
cgcaacttttgaaaagatagggggccaaaagtacaattaagcctt |
17235134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 22019762 - 22019702
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||| | ||||| ||||||||||| |||| |||||||| | ||||||||||||| |
|
|
| T |
22019762 |
tgatgatactaaggggacttaacttttgatgtcactatacaaacaatggggtgttactcac |
22019702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 26323421 - 26323377
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
26323421 |
taaccccaacttttggaaagataggggtcccaaagtgcaaataag |
26323377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 29560043 - 29560091
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||||| || |||||||||||||| |
|
|
| T |
29560043 |
taaccgcaacttttaaaaagataggggtccataaatgcaattaagcctt |
29560091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30894383 - 30894431
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| | ||||||| |||||||||||||| |
|
|
| T |
30894383 |
taaccacaacttttgaaaagatagggatccaaaaatgcaattaagcctt |
30894431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 41138603 - 41138559
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || | ||||||||||||||||||| |
|
|
| T |
41138603 |
cgcaacttttagaaagatagggggctaaaagtgcaattaagcctt |
41138559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42739573 - 42739525
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| ||| ||||||| |||||||||||| |
|
|
| T |
42739573 |
taaccacaacttttgaaaagataggggttcaaaagtacaattaagcctt |
42739525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 218)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 25701137 - 25701200
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25701137 |
ttgatgatactatgaggactgaacttttgatgtcactgtacaaacagtagggtgttactcacta |
25701200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 55241184 - 55241243
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55241184 |
ttgatgatactatggggactgaacttttgatgccactgtacaaacagtggggtgttactc |
55241243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 48278183 - 48278229
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48278183 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
48278229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 34948177 - 34948238
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
34948177 |
ttgatgatattatgaggactgaacttttgatgccactttacaaacagtggggtgttactcac |
34948238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 41205544 - 41205495
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41205544 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagccttg |
41205495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 49376098 - 49376037
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
49376098 |
ttgatgatactatgaagactgaacttttgatgccactgtacaagcagtggggtgttactcac |
49376037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 54556882 - 54556931
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54556882 |
taaccgcaacttttagaaagatagaggtccaaaagtgcaattaagccttg |
54556931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7396187 - 7396139
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7396187 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
7396139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7666246 - 7666198
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7666246 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
7666198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11529805 - 11529757
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11529805 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
11529757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27246905 - 27246857
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27246905 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
27246857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 36493768 - 36493832
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
36493768 |
ttgatgatactatggggactgaacttttgatgtcactgtacaaacaatggggtgttactcactat |
36493832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 37663821 - 37663881
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
37663821 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtggggtgttactca |
37663881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 41205763 - 41205811
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41205763 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
41205811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 51696582 - 51696534
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51696582 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
51696534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 52310847 - 52310799
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52310847 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
52310799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 55586662 - 55586614
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55586662 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcctt |
55586614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 104246 - 104199
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
104246 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
104199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4902423 - 4902470
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4902423 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
4902470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7705636 - 7705589
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7705636 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
7705589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 12641086 - 12641133
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12641086 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
12641133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13021246 - 13021293
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13021246 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
13021293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14578484 - 14578437
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14578484 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
14578437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 23315645 - 23315692
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23315645 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
23315692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24415341 - 24415388
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24415341 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
24415388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 37287855 - 37287804
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37287855 |
tatgaggattgaacttttgatgccactgtacaaacagtggggtgttactcac |
37287804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37289501 - 37289454
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37289501 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
37289454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42672335 - 42672382
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42672335 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
42672382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 51537476 - 51537429
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51537476 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
51537429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 52045767 - 52045720
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52045767 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
52045720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 52114401 - 52114460
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgttactat |
60 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||| | ||||||| |
|
|
| T |
52114401 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagccttgtttttactat |
52114460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 52311069 - 52311116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52311069 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
52311116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3770427 - 3770473
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3770427 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcc |
3770473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 4598108 - 4598062
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4598108 |
ggactgaacttttgatgccactgtacaaacagtggggtgttactcac |
4598062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 11159687 - 11159733
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11159687 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
11159733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 17262352 - 17262398
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17262352 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
17262398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 21536926 - 21536880
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21536926 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
21536880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27247126 - 27247172
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27247126 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
27247172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 43821765 - 43821719
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43821765 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
43821719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 31844054 - 31844099
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31844054 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
31844099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 50764861 - 50764800
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
50764861 |
ttgatgatactatgaggattgaacttttgatgtcaccgtacaaacagtggggtgttactcac |
50764800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 104467 - 104515
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
104467 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcctt |
104515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5344316 - 5344268
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5344316 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
5344268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5344538 - 5344586
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5344538 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcctt |
5344586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 6386777 - 6386729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6386777 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
6386729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7705856 - 7705904
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
7705856 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagcctt |
7705904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11530027 - 11530075
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
11530027 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
11530075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12640866 - 12640818
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
12640866 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
12640818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17554091 - 17554043
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
17554091 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
17554043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 19089533 - 19089593
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
19089533 |
ttgatgatactatgaggactgaacttttgatgtcattatacaaacagtggggtgttactca |
19089593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20473978 - 20474026
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
20473978 |
taaccgcaacttttggaaagataggggtctaaaagtgcaattaagcctt |
20474026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27751209 - 27751161
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27751209 |
taaccacaacttttggaaacatagaggtccaaaagtgcaattaagcctt |
27751161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 29584280 - 29584340
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29584280 |
ttgatgatactatgaagactgaacttttgatgccattgtacaaacagtgaggtgttactca |
29584340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30998451 - 30998499
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30998451 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
30998499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34362866 - 34362818
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34362866 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
34362818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39136564 - 39136612
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39136564 |
taaccgctacttttggaaagataggggtccaaaagtgcaattaagcctt |
39136612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 44921877 - 44921925
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
44921877 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
44921925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45289767 - 45289815
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45289767 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
45289815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 47854022 - 47853974
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
47854022 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
47853974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 52045983 - 52046031
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52045983 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcctt |
52046031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 56296663 - 56296619
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56296663 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
56296619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 232958 - 233005
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
232958 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
233005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 1377651 - 1377604
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1377651 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcct |
1377604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3066006 - 3065959
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
3066006 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
3065959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4902182 - 4902135
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4902182 |
taacagcaacttttggaaagataggggtccaaaagtgcaattaagcct |
4902135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7644503 - 7644456
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7644503 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
7644456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8483127 - 8483174
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
8483127 |
taaccgcaacttttgaaaaaatagaggtccaaaagtgcaattaagcct |
8483174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10046203 - 10046250
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10046203 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
10046250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13607963 - 13607916
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
13607963 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
13607916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 18988225 - 18988178
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18988225 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
18988178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 20472595 - 20472552
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20472595 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
20472552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20472813 - 20472860
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
20472813 |
taaccgcaacttttggaaagataggggtccaaaagtacaattaagcct |
20472860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 22160095 - 22160142
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
22160095 |
taaccgcaacttttggaaagataggggtctaaaagtgcaattaagcct |
22160142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 23770034 - 23770077
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23770034 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
23770077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24415119 - 24415072
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24415119 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
24415072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 26675099 - 26675052
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26675099 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
26675052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 26675323 - 26675369
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26675323 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaagcct |
26675369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 27751431 - 27751474
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27751431 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
27751474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 29548226 - 29548179
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29548226 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcct |
29548179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29548447 - 29548494
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29548447 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
29548494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30998229 - 30998182
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
30998229 |
taaccgcaacttttggaaagatagaggtctaaaagtgcagttaagcct |
30998182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31250736 - 31250783
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31250736 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
31250783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 33338298 - 33338345
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
33338298 |
aaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
33338345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 103
Target Start/End: Complemental strand, 33341529 - 33341475
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtt |
103 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33341529 |
ttgatgatactatg-ggactgaacttttgatgccactgtacaaacagtggggtgtt |
33341475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 34957624 - 34957667
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34957624 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
34957667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 35364462 - 35364509
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35364462 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcct |
35364509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 39136344 - 39136297
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39136344 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
39136297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43821965 - 43822012
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43821965 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
43822012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47821521 - 47821474
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
47821521 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaagcct |
47821474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 47854247 - 47854294
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
47854247 |
taaccgcaacttttggaaatataggggtccaaaagtgcaattaagcct |
47854294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 51696796 - 51696843
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
51696796 |
taaccgcaacttttggaaagataggggtccaaaagtgctattaagcct |
51696843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 54216002 - 54215955
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
54216002 |
taaccgcaactttcggaaagataggggtccaaaagtgcaattaagcct |
54215955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 54556660 - 54556613
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
54556660 |
taaccgcaacttttggaaaaataggggtccaaaagtgcaattaagcct |
54556613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 55586884 - 55586931
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
55586884 |
taaccgcaactttcggaaagataggggtccaaaagtgcaattaagcct |
55586931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 7666465 - 7666511
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7666465 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcc |
7666511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 17266014 - 17266060
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
17266014 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
17266060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 33508215 - 33508261
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33508215 |
accgcaacttttggaaagataggggtccaaaagtgaaattaagcctt |
33508261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 34363085 - 34363131
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34363085 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
34363131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 35083852 - 35083894
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35083852 |
cgcaacttttgaaaagatagaggtccaaaagtgcaattaagcc |
35083894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 51537883 - 51537929
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
51537883 |
taaccgcaacttttggaaagataggggtccaaaagtgaaattaagcc |
51537929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 54216224 - 54216270
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
54216224 |
taaccgcaacttttgaaaagatagaggttcaaaagtgcaattaagcc |
54216270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 106
Target Start/End: Complemental strand, 7703647 - 7703590
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
7703647 |
tgatgatactatggggactgaacttttgatgtcaccgtacaaacagtggggtgttact |
7703590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 22159875 - 22159830
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
22159875 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagc |
22159830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 23761203 - 23761142
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
23761203 |
ttgatgatactatggggactgaacttttgatgtcactatacaaacagtgaggtgttactcac |
23761142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 109
Target Start/End: Complemental strand, 37775780 - 37775739
Alignment:
| Q |
68 |
gaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37775780 |
gaacttttgatgccactgtacaaacagtggggtgttactcac |
37775739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7119640 - 7119592
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
7119640 |
taaccgcaacttttggaaagatagggatccaaaagtacaattaagcctt |
7119592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 8891700 - 8891656
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
8891700 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaag |
8891656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 9139376 - 9139312
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||| ||||||||| ||| |||||||||||| || |||||||||||||||| |
|
|
| T |
9139376 |
ttgatgatactatggggattgaactttttatgtcactgtacaaacggtggggtgttactcactat |
9139312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 26171507 - 26171551
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26171507 |
taaccgtaacttttgaaaagatagaggtccaaaagtgcaattaag |
26171551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 27396747 - 27396687
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
27396747 |
ttgatgatactatgaggacgaaacttttgatgtcattgtacaaacagtagggtgttactca |
27396687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 109
Target Start/End: Original strand, 30002705 - 30002765
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||| || |||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30002705 |
tgatgatactaagaagactgaacttttgatgtcactgtacaaacagtgaggtgttactcac |
30002765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 37432485 - 37432529
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
37432485 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
37432529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 38371531 - 38371579
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
38371531 |
taaccgcaatttttgaaaagatagaggtccaaaagtgcgattaagcctt |
38371579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 41707764 - 41707720
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41707764 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
41707720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42672114 - 42672070
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42672114 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaag |
42672070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 46282806 - 46282758
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
46282806 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
46282758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 47253878 - 47253819
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||| ||||| | ||||||||||||| |
|
|
| T |
47253878 |
tgatgatactatgaggactgaacttttgatgtcactgtataaacaat-gggtgttactcac |
47253819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 47821590 - 47821638
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| |||||||||| |||| ||||||||||||||||||| |
|
|
| T |
47821590 |
taaccgcaactttcggaaagataggggtctaaaagtgcaattaagcctt |
47821638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 50513309 - 50513353
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
50513309 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
50513353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3066794 - 3066841
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
3066794 |
taaccgcaacttttggaaagttatgggtccaaaagtgcaattaagcct |
3066841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 4049394 - 4049433
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4049394 |
cgcaacttttggaaagatagagggccaaaagtgcaattaa |
4049433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 4934283 - 4934346
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagt-cgggtgttactcacta |
111 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
4934283 |
tgatgatactatgaggattgaacttttgatgccagtgtacaaacaatgggggtgttactcacta |
4934346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7119861 - 7119908
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
7119861 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
7119908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7644726 - 7644773
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7644726 |
taaccgcaacttttagaaagataggggttcaaaagtgcaattaagcct |
7644773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8482905 - 8482858
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
8482905 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaagcct |
8482858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 13209730 - 13209773
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
13209730 |
cgcaacttttggaaagttagagggccaaaagtgcaattaagcct |
13209773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 14578707 - 14578754
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14578707 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
14578754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 17262136 - 17262089
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
17262136 |
taaccgcaacttttgaaaagatagtggtccaagagtgcaattaagcct |
17262089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 18994713 - 18994670
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18994713 |
taaccgcaacttttcgaaagataggggtccaaaagtgcaattaa |
18994670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 19869425 - 19869468
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19869425 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaa |
19869468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24542800 - 24542753
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24542800 |
taaccgtaacttttgaaaagataggggtccaaaagtgcaattaagcct |
24542753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 28003066 - 28003113
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
28003066 |
ttgatgatactatgatgactgaacttttgatgtcactgtacaaacagt |
28003113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29627874 - 29627921
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
29627874 |
taaccgcaacttttggaaagataggggtccaaaaatgcaactaagcct |
29627921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 31209485 - 31209528
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31209485 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
31209528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 31250524 - 31250481
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31250524 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
31250481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 35083626 - 35083579
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35083626 |
taaccccaactttcggaaagatagaggttcaaaagtgcaattaagcct |
35083579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 37973559 - 37973516
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37973559 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaa |
37973516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 37973782 - 37973829
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
37973782 |
taaccgcaacttttggaaagataggagtccaaaagtgcaactaagcct |
37973829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38371317 - 38371270
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38371317 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
38371270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 39332365 - 39332318
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
39332365 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
39332318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 39946126 - 39946079
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39946126 |
taaccgcaacttttagaaagataatggtccaaaagtgcaattaagcct |
39946079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 41787095 - 41787048
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
41787095 |
taaccgcaattttttgaaagataggggtccaaaagtgcaattaagcct |
41787048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45289546 - 45289499
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
45289546 |
taaccgcaacttttgaaaagataggggtccaaaagtgcatttaagcct |
45289499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 51537698 - 51537737
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaa |
40 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51537698 |
taaccgcaacttttggaaagataggggtccaaaagtgcaa |
51537737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10046001 - 10045956
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10046001 |
taaccgcaacttt-ggaaagataggggtccaaaagtgcaattaagcc |
10045956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 13019319 - 13019273
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
13019319 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcc |
13019273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 17554317 - 17554359
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17554317 |
cgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
17554359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 18995070 - 18995116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
18995070 |
taaccgcaacttttggaaagataggggtccaaaaatacaattaagcc |
18995116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 20466431 - 20466385
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
20466431 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcc |
20466385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 21537149 - 21537191
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21537149 |
gcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
21537191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 29432092 - 29432050
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29432092 |
aaccgcaatttttggaaagataggggtccaaaagtgcaattaa |
29432050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35364242 - 35364196
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35364242 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcc |
35364196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 36413979 - 36414021
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
36413979 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcc |
36414021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39946344 - 39946390
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39946344 |
taaccacaacttttggaaagataagggtccaaaagtgcaattaagcc |
39946390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 44822480 - 44822438
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
44822480 |
gcaacttttggaaagataggggtccaaaggtgcaattaagcct |
44822438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 50996081 - 50996035
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
50996081 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagcc |
50996035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 17265895 - 17265850
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
17265895 |
taaccgcaacttttagaaagataggggtccaaaagtacaattaagc |
17265850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 19693063 - 19693018
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19693063 |
taaccacaacttttggaaagttaggggtccaaaagtgcaattaagc |
19693018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 19703648 - 19703603
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19703648 |
taaccacaacttttggaaagttaggggtccaaaagtgcaattaagc |
19703603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 31209270 - 31209225
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31209270 |
taaccgcaacttttggaaagatatgggtccaaaagtccaattaagc |
31209225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 35835822 - 35835773
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||| || ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
35835822 |
taaccgtaaattttgaaaagataggggtccaaaagtgcaattaagccttg |
35835773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37289723 - 37289768
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
37289723 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagc |
37289768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 39398033 - 39397988
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
39398033 |
gactgaacttttgatgtcactgtacaaacaatggggtgttactcac |
39397988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 111
Target Start/End: Original strand, 46888247 - 46888300
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| ||| |||| |||||||||| |
|
|
| T |
46888247 |
tatggggactgaacttttgatgccgctgtacaaatagtggggtattactcacta |
46888300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 55477971 - 55478016
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
55477971 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaaca |
55478016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 6386999 - 6387047
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
6386999 |
taaccgcaacttttagaaagatagggggtccaaaagtgcaattaagcct |
6387047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 92
Target Start/End: Original strand, 19440728 - 19440772
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaac |
92 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19440728 |
ttgatgatattatgaggactgaacttttgatgccattgtacaaac |
19440772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 50513091 - 50513043
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50513091 |
taactgcaacttttgaaaagataggagtccaaaagtgcaattaagcctt |
50513043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1377854 - 1377901
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||| ||||| |
|
|
| T |
1377854 |
taaccgcaacttttgaaaagataggggtcctaaagtgcaatttagcct |
1377901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 49
Target Start/End: Complemental strand, 2016296 - 2016253
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
2016296 |
gcaacttttgaaaagatagggggccaaaagtgcaattaagcctt |
2016253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 2016700 - 2016743
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
2016700 |
cgcaacttttggaaagatagtgggcaaaaagtgcaattaagcct |
2016743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 3770221 - 3770178
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3770221 |
cgcaactttaagaaagataggggtccaaaagtgcaattaagcct |
3770178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 6768843 - 6768800
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
6768843 |
taaccgcaacttttagaaagataagggtccaaaagtgcaattaa |
6768800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 18988450 - 18988493
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18988450 |
ccgcaacttttaaaaagataggggtccaaaagtgcaattaagcc |
18988493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 19725697 - 19725658
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19725697 |
acttttggaaagatagggggccaaaagtgcaattaagcct |
19725658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 24543010 - 24543053
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
24543010 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaa |
24543053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 26171287 - 26171240
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26171287 |
taactgcaacttttgaaaagataagggtccaaaagtgcaattaagcct |
26171240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28158942 - 28158899
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
28158942 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaa |
28158899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28981959 - 28981912
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
28981959 |
taaccgcaacttttgaaaagataggggtccaaaagtgcatataagcct |
28981912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 28982179 - 28982222
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
28982179 |
taaccgcaacttttgaaaaaatataggtccaaaagtgcaattaa |
28982222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29432314 - 29432361
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||| |||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
29432314 |
taaccgtaacttttgaaaagatagggatccaaaagtgcaattaagcct |
29432361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 32592224 - 32592165
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||| |||| |||||||||| | ||||||||| |
|
|
| T |
32592224 |
ttgatgatactaaggggactgaacttttgatgtcactatacaaacagtggagtgttactc |
32592165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 34158517 - 34158474
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34158517 |
taaccgcaatttttggaaagataggggtccaaaaatgcaattaa |
34158474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 34158740 - 34158783
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
34158740 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaa |
34158783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 34957423 - 34957377
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
34957423 |
taaccgcaacttttgaaaagatag-gatccaaaagtgcaattaagcct |
34957377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 35021115 - 35021178
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||| |||| |||||||||||| | ||||||||||||| |
|
|
| T |
35021115 |
ttgatgatactacgaggacgaaacttttgacgccaatgtacaaacagtggtgtgttactcacta |
35021178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39332565 - 39332612
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
39332565 |
taaccgcaacttttaaaaagataggggttcaaaagtgcaattaagcct |
39332612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 41788331 - 41788378
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| | ||||||||||||| |
|
|
| T |
41788331 |
taaccgcaacttttgaaaagatagaggttcaacactgcaattaagcct |
41788378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 8891920 - 8891966
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
8891920 |
taaccacaacttttgaaaagataggggtcctaaagtgcaattaagcc |
8891966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 9592402 - 9592444
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
9592402 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
9592444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 109
Target Start/End: Complemental strand, 17167825 - 17167783
Alignment:
| Q |
67 |
tgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
17167825 |
tgaacttttgatgtcattgtacaaacagtggggtgttactcac |
17167783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 109
Target Start/End: Complemental strand, 17173402 - 17173360
Alignment:
| Q |
67 |
tgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
17173402 |
tgaacttttgatgtcattgtacaaacagtggggtgttactcac |
17173360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 24886573 - 24886531
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
24886573 |
gcaacttttgaaaagataggggaccaaaagtgcaattaagcct |
24886531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 33338095 - 33338049
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
33338095 |
taaccgcaacttttggaaatatatgggtccaaaagtacaattaagcc |
33338049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 35025669 - 35025731
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| || ||| ||||||| ||||| ||||||||| |
|
|
| T |
35025669 |
tgatgatactacgaggactgaacttttgatgtcaacgtataaacagtggggtgctactcacta |
35025731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 36945555 - 36945513
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
36945555 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
36945513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39668918 - 39668872
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
39668918 |
taaccgcaatttttagaaagatagagatccaaaagtacaattaagcc |
39668872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 48277962 - 48277916
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
48277962 |
taaccacaacttttgaaaagataggggtccaaaaatgcaattaagcc |
48277916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 1186960 - 1187001
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
1186960 |
gcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
1187001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 12892866 - 12892825
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
12892866 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagc |
12892825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 29860694 - 29860653
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
29860694 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagc |
29860653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 111
Target Start/End: Complemental strand, 38011975 - 38011922
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||| ||||| || |||||| |
|
|
| T |
38011975 |
tatggggactgaacttttgatggcaccgtacaaacagtggggtgctattcacta |
38011922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 6769063 - 6769107
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
6769063 |
taaccacaacttttgaaaagataggggtccaaaagtgtaattaag |
6769107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 104
Target Start/End: Complemental strand, 6864166 - 6864110
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtta |
104 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| | |||||||| ||| || ||||| |
|
|
| T |
6864166 |
ttgatgatactatgaggactggacttttgatgctattgtacaaaaagttggatgtta |
6864110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 17221569 - 17221617
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||| |||||||||||| |
|
|
| T |
17221569 |
taaccgcaacttttgaaaagataaggatccaaaagtacaattaagcctt |
17221617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 22589463 - 22589507
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||| |||| |
|
|
| T |
22589463 |
cgcaacttttagaaagatagggggccaaaagtgcaattaaacctt |
22589507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 23419601 - 23419645
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
23419601 |
taaccacaacttttaaaaagataggggtccaaaagtgcaattaag |
23419645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 23777076 - 23777032
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||||| | | ||||||||||||||||||||| |
|
|
| T |
23777076 |
cgcaacttttgaaaagataaaaggccaaaagtgcaattaagcctt |
23777032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 25184244 - 25184184
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| || |||||||| |||| || |||||||||||| | |||||||||| |
|
|
| T |
25184244 |
ttgatgatactatgaagattgaactttggatgtcattgtacaaacagtagagtgttactca |
25184184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 26858386 - 26858342
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
26858386 |
cgcaacttttaaaaagatagggggccaaaagtgcaattaagcctt |
26858342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 28291925 - 28291969
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||| |||| |
|
|
| T |
28291925 |
cgcaacttttggaaagatagggggctaaaagtgcaattaaacctt |
28291969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 45
Target Start/End: Original strand, 29860852 - 29860892
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
29860852 |
cgcaacttttggaaagatggggggccaaaagtgcaattaag |
29860892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31560087 - 31560039
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||| ||||||| |||| |
|
|
| T |
31560087 |
taaccgcaacttttagaaagaaaggggtccaaaagtacaattaaacctt |
31560039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31843833 - 31843785
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||| |||||| |||| |
|
|
| T |
31843833 |
taaccacaacttttgaaaagataggggtccaaaagtgtaattaaacctt |
31843785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 44921660 - 44921612
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
44921660 |
taaccgcaacttttaaaaagataagggtccaaaagtgcaattaaacctt |
44921612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 49869295 - 49869251
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
49869295 |
cgcaacttttgaaaagatagggagccaaaagtgcaattaagcctt |
49869251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 54606933 - 54606886
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| | |||||||||||| |
|
|
| T |
54606933 |
taaccgcaacttttgaaaagataggggtccaaaa-tacaattaagcctt |
54606886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 56296865 - 56296913
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||| || ||||||||| |||| |
|
|
| T |
56296865 |
taaccgcaacttttgaaaagataggggtccagaaatgcaattaaacctt |
56296913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 201)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 5657536 - 5657597
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5657536 |
ttgatgatactatgaagactgaacttttgatgccactgtacaaacagtggggtgttactcac |
5657597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19194428 - 19194476
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19194428 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
19194476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 3235383 - 3235431
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3235383 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
3235431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11900096 - 11900048
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11900096 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
11900048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11900317 - 11900365
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11900317 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
11900365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16879505 - 16879553
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16879505 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
16879553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 19194206 - 19194158
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19194206 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
19194158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21782649 - 21782601
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21782649 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
21782601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27432536 - 27432488
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27432536 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
27432488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34288094 - 34288046
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34288094 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
34288046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35437481 - 35437529
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35437481 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
35437529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 36376106 - 36376058
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36376106 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
36376058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 37347128 - 37347068
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
37347128 |
ttgatgatactatgaggactgaacttttgatgtcactgtacaaacaatggggtgttactca |
37347068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 46622600 - 46622552
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46622600 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
46622552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5096834 - 5096787
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5096834 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
5096787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7974658 - 7974705
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7974658 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
7974705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 21991742 - 21991683
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21991742 |
ttgatgatactatggggactgaacttttgatgacactgtacaaacagtggggtgttactc |
21991683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25983035 - 25982988
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25983035 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
25982988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 32821108 - 32821171
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||||||||||| | ||||||||||||| |
|
|
| T |
32821108 |
ttgatgatactacgaggactgaacttttgatgccattgtacaaacagtggtgtgttactcacta |
32821171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 39753918 - 39753871
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39753918 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
39753871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 41765133 - 41765196
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
41765133 |
ttgatgatactatgaggactggacttttgatgccaccgtacaaacagtggggtgctactcacta |
41765196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42997102 - 42997055
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42997102 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
42997055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 19233586 - 19233632
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19233586 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
19233632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39976775 - 39976729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39976775 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
39976729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 43408270 - 43408224
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43408270 |
taaccgcaacttttggaaagatagaggtccaaaagtgaaattaagcc |
43408224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 26980429 - 26980368
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| || |||| |||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
26980429 |
ttgatgatattatggggactgaacttttgatgccactgtacaaaccgtggggtgttactcac |
26980368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 29173646 - 29173585
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| | ||||||||||| |
|
|
| T |
29173646 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtggagtgttactcac |
29173585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 55 - 108
Target Start/End: Complemental strand, 30055626 - 30055573
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
30055626 |
tactatgaggactgaacttttgatgtcattgtacaaacagtggggtgttactca |
30055573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 43632387 - 43632334
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgt |
54 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
43632387 |
taaccgcaatttttggaaagataggggtccaaaagtgcaattaagcctttatgt |
43632334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 44189451 - 44189406
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44189451 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
44189406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3925839 - 3925791
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
3925839 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
3925791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 7334900 - 7334840
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
7334900 |
ttgatgatactatgagaactgaacttttgatgtcattgtacaaacagtggggtgttactca |
7334840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 104
Target Start/End: Complemental strand, 8861391 - 8861335
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtta |
104 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8861391 |
ttgatgatactatggggacttaacttttgatgccactgtacaaacagtggggtgtta |
8861335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10312494 - 10312542
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10312494 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcctt |
10312542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 11071312 - 11071248
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||||||||| | ||||||||| |||| |
|
|
| T |
11071312 |
ttgatgatactatgagaactgaacttttgatgtcactgtacaaacagtggagtgttactcgctat |
11071248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 18074082 - 18074130
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18074082 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcctt |
18074130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 18363561 - 18363609
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18363561 |
taaccgcaacttttgcaaagataggggtccaaaagtgcaattaagcctt |
18363609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 18797433 - 18797373
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
18797433 |
ttgatgatactatgaggattgaacttttgatgtcattgtacaaacagtggggtgttactca |
18797373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 18852541 - 18852493
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18852541 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
18852493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23909941 - 23909893
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23909941 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
23909893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25987190 - 25987238
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25987190 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaatcctt |
25987238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26612388 - 26612340
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
26612388 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
26612340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27512848 - 27512800
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
27512848 |
taaccgcaacttttgtaaagataggggtccaaaagtgcaattaagcctt |
27512800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30085667 - 30085619
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30085667 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
30085619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32555568 - 32555616
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32555568 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaagcctt |
32555616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 109
Target Start/End: Original strand, 34362205 - 34362264
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||||||| |||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
34362205 |
tgatgatactatgagaactgaacttt-gatgccactgtacaaacagtggggtgttactcac |
34362264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34533260 - 34533212
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34533260 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcctt |
34533212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34533480 - 34533528
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34533480 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
34533528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 35923938 - 35923894
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35923938 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
35923894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35924158 - 35924206
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35924158 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
35924206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36376329 - 36376377
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
36376329 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
36376377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 38879420 - 38879464
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38879420 |
ccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
38879464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40436082 - 40436034
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40436082 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
40436034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43408471 - 43408519
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
43408471 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
43408519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 48871355 - 48871403
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
48871355 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
48871403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 930975 - 931022
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
930975 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
931022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 9629283 - 9629330
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
9629283 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
9629330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10356365 - 10356412
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
10356365 |
taaccgcaacttttggaaatataggggtccaaaagtgcaattaagcct |
10356412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 18295898 - 18295855
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18295898 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
18295855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 18296118 - 18296165
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
18296118 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcct |
18296165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 18852760 - 18852807
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18852760 |
taacctcaacttttggaaagataggggtccaaaagtgcaattaagcct |
18852807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 19233386 - 19233339
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19233386 |
taaccgcaacttttggaaagatagggttccaaaagtgcaattaagcct |
19233339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 19778521 - 19778568
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19778521 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
19778568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 21917517 - 21917564
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21917517 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
21917564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 25983258 - 25983317
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgttactat |
60 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||| || ||||||| |
|
|
| T |
25983258 |
taaccgcaacttttaaaaagatagaggcccaaaagtgcaattaagcctttattttactat |
25983317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25986971 - 25986924
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25986971 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
25986924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30086570 - 30086617
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
30086570 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
30086617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30140966 - 30140919
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30140966 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
30140919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30141187 - 30141234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30141187 |
taaccgcaacttttgcaaagataggggtccaaaagtgcaattaagcct |
30141234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 35121680 - 35121727
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35121680 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
35121727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 35437252 - 35437205
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
35437252 |
taaccgcaacttttggaaagataggggtccaaatgtgcaattaagcct |
35437205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 37452316 - 37452363
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37452316 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
37452363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38879207 - 38879160
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
38879207 |
taaccgcaacttttgaaaagatagaggtccaaaagtacaattaagcct |
38879160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44214705 - 44214658
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44214705 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
44214658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 388168 - 388214
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
388168 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
388214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3926025 - 3926071
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
3926025 |
taaccgcaacttttggaaatataggggtccaaaagtgcaattaagcc |
3926071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 3931692 - 3931646
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3931692 |
taaccccaacttttgaaaagatagaggtccaaaagtgcaattaagcc |
3931646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 4061255 - 4061301
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
4061255 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcc |
4061301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 10319160 - 10319206
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10319160 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
10319206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 10385720 - 10385762
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10385720 |
cgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
10385762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10715884 - 10715838
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10715884 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcc |
10715838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 12165843 - 12165797
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12165843 |
ggacttaacttttgatgccactgtacaaacagtggggtgttactcac |
12165797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 18073862 - 18073816
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
18073862 |
taaccgcaacttttggaaagataggggtctaaaagtgcaattaagcc |
18073816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 23910122 - 23910168
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23910122 |
taaccgcaacttttgaaaagatagtggtccaaaagtgcaattaagcc |
23910168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 26612610 - 26612656
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26612610 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
26612656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 30699291 - 30699337
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
30699291 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
30699337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 38445673 - 38445719
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38445673 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
38445719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 38882640 - 38882690
Alignment:
| Q |
1 |
taaccgcaacttttggaaa-gatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
38882640 |
taaccgcaacttttggaaaagataggggtccaaaagtgcaattaagccttg |
38882690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 22687345 - 22687284
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| |||||| ||||||||| | ||||||||||| |
|
|
| T |
22687345 |
ttgatgatactatggggactgaacttttgataccactgcacaaacagtggagtgttactcac |
22687284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 25683949 - 25683990
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25683949 |
aacttttggaaagataggggtccaaaagtgcaattaagcctt |
25683990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7974435 - 7974387
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
7974435 |
taaccgcaacttttggaaaaataggggttcaaaagtgcaattaagcctt |
7974387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 10318937 - 10318889
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
10318937 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
10318889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23740310 - 23740262
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
23740310 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
23740262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 24211847 - 24211787
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| | || ||||||| |||||||||||| |
|
|
| T |
24211847 |
ttgatgatactatgagggctgaacttttgatgccattctataaacagtagggtgttactca |
24211787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 27513068 - 27513116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
27513068 |
taaccgcaactttcgaaaagataggggtccaaaagtgcaattaagcctt |
27513116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30699069 - 30699021
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30699069 |
taactgcaacttttggaaagatagggatccaaaagtgcaattaagcctt |
30699021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 31520779 - 31520842
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||| | | |||||||||||||| |
|
|
| T |
31520779 |
ttgatgatactatg-ggactgaacttttgatgtcactgtacaaacaatggagtgttactcactat |
31520842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 37047933 - 37047977
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
37047933 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
37047977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 38053182 - 38053142
Alignment:
| Q |
11 |
ttttggaaagatagaggtccaaaagtgcaattaagccttga |
51 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38053182 |
ttttggaaagataggggtccaaaagtgcaattaagccttga |
38053142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 228003 - 227960
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
228003 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
227960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 228226 - 228273
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
228226 |
aaccgcaacttttgaaaagataggggtccaaaagtgcaattaaacctt |
228273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3931761 - 3931804
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
3931761 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaa |
3931804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7195725 - 7195772
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
7195725 |
taaccgcaacttttggaaaaatataggtccaaaagtggaattaagcct |
7195772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10356163 - 10356116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
10356163 |
taaccgcaacttttggaaagatagagatctaaaaatgcaattaagcct |
10356116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10986046 - 10986003
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10986046 |
taaccgcaacttttgaaaagatagaggtctaaaagtgcaattaa |
10986003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 11275233 - 11275190
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
11275233 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
11275190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 11578323 - 11578370
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
11578323 |
taaccgcaacctttggaaagataggggtccaaaagtacaattaagcct |
11578370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16879281 - 16879234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
16879281 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
16879234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 18363337 - 18363294
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
18363337 |
cgcaacttttggaaacataggggtccaaaagtgcaattaagcct |
18363294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 18798076 - 18798033
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18798076 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaa |
18798033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 18798277 - 18798320
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
18798277 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaa |
18798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19778320 - 19778277
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
19778320 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
19778277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 23740532 - 23740579
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23740532 |
taaccgcaacttttcgaaagataggggtccaaaagtacaattaagcct |
23740579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30757270 - 30757223
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30757270 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcct |
30757223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 35121459 - 35121412
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
35121459 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
35121412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35711925 - 35711968
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35711925 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
35711968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37996063 - 37996016
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37996063 |
taaccgcaacgtttgaaaagataggggtccaaaagtgcaattaagcct |
37996016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 45231787 - 45231830
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45231787 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaa |
45231830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 930754 - 930708
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| ||||||||| |
|
|
| T |
930754 |
taaccgcaacttttgaaaagataggggtccaaaagtgtaattaagcc |
930708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 4583018 - 4582964
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||| ||| ||||||||||||| |
|
|
| T |
4583018 |
tactatggggactgaacttttgatgtcattgtacaaatagtggggtgttactcac |
4582964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 16537123 - 16537077
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
16537123 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcc |
16537077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 16628539 - 16628585
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
16628539 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcc |
16628585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 11 - 45
Target Start/End: Original strand, 17758039 - 17758073
Alignment:
| Q |
11 |
ttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17758039 |
ttttggaaagatagaggtccaaaagtgcaattaag |
17758073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 24775892 - 24775938
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
24775892 |
taaccacaacttttggagagataggggtccaaaagtgcaattaagcc |
24775938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 34404489 - 34404443
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
34404489 |
taaccgcaatttttggaaagataggggtctaaaagtgcaattaagcc |
34404443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 38053415 - 38053461
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38053415 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcc |
38053461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 42997319 - 42997365
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
42997319 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcc |
42997365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 43686131 - 43686086
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
43686131 |
ggactgaacttttgatgccattgtacaaacagt-gggtgttactcac |
43686086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 45231568 - 45231522
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
45231568 |
taaccgtaacttttgaaaagataggggtccaaaagtgcaattaagcc |
45231522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 45863243 - 45863284
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45863243 |
gcaacttttggaaagatagagg-ccaaaagtgcaattaagcct |
45863284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 5097052 - 5097097
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5097052 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagc |
5097097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 108
Target Start/End: Original strand, 15612829 - 15612874
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
15612829 |
ggactgaacttttgatgccactctacaaacactggggtgttactca |
15612874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 26524382 - 26524427
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca |
93 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
26524382 |
ttgatgatactatgaggactggacttttgatgccactgcacaaaca |
26524427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 108
Target Start/End: Complemental strand, 27283843 - 27283790
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| || |||||||||||| |
|
|
| T |
27283843 |
tactatgaggactgaacttttgatttcattgtacaaacggtggggtgttactca |
27283790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 32432558 - 32432497
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| || |||||||||| | ||||||||||||| |
|
|
| T |
32432558 |
ttgatgatactatggagactgaacttttgatgtcattgtacaaacaatggggtgttactcac |
32432497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 47731748 - 47731699
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
47731748 |
taaccgcaattttttaaaagataggggtccaaaagtgcaattaagccttg |
47731699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 497158 - 497110
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
497158 |
taactgcaacttttgaaaagataagggtccaaaagtgcaattaagcctt |
497110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 4061034 - 4060990
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
4061034 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaag |
4060990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 9035404 - 9035356
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
9035404 |
taaccgcaacttttaaaaagataggggtccaaaattgcaattaagcctt |
9035356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 9035629 - 9035673
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9035629 |
taaccgcaacttttggaaagataggaatccaaaagtgcaattaag |
9035673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 10350852 - 10350804
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
10350852 |
taaccacaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
10350804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 16705703 - 16705747
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
16705703 |
taaccgcaacttttgaaaagataaaggtccaaaaatgcaattaag |
16705747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 17679939 - 17679983
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
17679939 |
taaccgcaacttttgaaaagataaaggtccaaaaatgcaattaag |
17679983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17757816 - 17757768
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
17757816 |
taaccgcaacttttaaaaagataggggtctaaaagtgcaattaagcctt |
17757768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 18201396 - 18201352
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
18201396 |
cgcaacttttagaaagatagtgggccaaaagtgcaattaagcctt |
18201352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 20387599 - 20387555
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20387599 |
taactgcaacttttggaaagataagggtccaaaagtgcaattaag |
20387555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20387817 - 20387865
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20387817 |
taaccacaacttttgaaaagatatgggtccaaaagtgcaattaagcctt |
20387865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 20392073 - 20392029
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20392073 |
taactgcaacttttggaaagataagggtccaaaagtgcaattaag |
20392029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20392291 - 20392339
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20392291 |
taaccacaacttttgaaaagatatgggtccaaaagtgcaattaagcctt |
20392339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 45
Target Start/End: Original strand, 20588426 - 20588466
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
20588426 |
cgcaacttttgaaaagatagagggccaaaagtgcaattaag |
20588466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 21202873 - 21202917
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
21202873 |
cgcaacttttggaaagatagggggccaaaagtgcaattaaacctt |
21202917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21917132 - 21917084
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||| |||| | |||||||||||||||||||||| |
|
|
| T |
21917132 |
taaccgcaacttttgaaaaaatagggatccaaaagtgcaattaagcctt |
21917084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 21954346 - 21954390
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
21954346 |
cgcaacttttggaaagatagggggtcaaaagtgcaattaagcctt |
21954390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 30028440 - 30028396
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
30028440 |
taaccgcaacttttagaaagataggggtcctaaagtgcaattaag |
30028396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30401175 - 30401223
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30401175 |
taaccacaacttttgaaaagataggagtccaaaagtgcaattaagcctt |
30401223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 31530392 - 31530432
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
31530392 |
caacttttggaaagatagggggccaaaagtgcaattaagcc |
31530432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 108
Target Start/End: Original strand, 33688333 - 33688377
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||||| |
|
|
| T |
33688333 |
gactgaacttttgatgccactggacaaacagtaggatgttactca |
33688377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34404702 - 34404750
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
34404702 |
taaccgcaacttttggaaagataagggttcaaaagtgcacttaagcctt |
34404750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35711704 - 35711657
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
35711704 |
taaccgcaacttt-gaaaagataggggtccaaaagtgcaattaagcctt |
35711657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 38053584 - 38053532
Alignment:
| Q |
56 |
actatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||| |||| ||||||| |
|
|
| T |
38053584 |
actatgagaactgaacttttgatgtcattgtacaaacagtagggttttactca |
38053532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 38258651 - 38258591
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
38258651 |
ttgatgatactatgaggattgaacttttgatgtcattgtacaaacggtgtggtgttactca |
38258591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 40139571 - 40139527
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
40139571 |
cgcaacttttagaaagataggggcccaaaagtgcaattaagcctt |
40139527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 40139832 - 40139876
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
40139832 |
cgcaacttttagaaagatagggggccaaaagtgcaattaagcctt |
40139876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 44189651 - 44189699
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||| |||| |
|
|
| T |
44189651 |
taaccgcaacttttgaaaagataggggtccagaagtgcaattaaacctt |
44189699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 47731970 - 47732014
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
47731970 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaag |
47732014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 16537344 - 16537391
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
16537344 |
taaccacaacttttcgaaagacaggggtccaaaagtgcaattaagcct |
16537391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16628318 - 16628271
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
16628318 |
taaccacaacttttcgaaagacaggggtccaaaagtgcaattaagcct |
16628271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 22164968 - 22164925
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
22164968 |
cgcaacttttagaaagatagagggccaaaagtacaattaagcct |
22164925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 22223675 - 22223632
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
22223675 |
cgcaacttttagaaagatagagggccaaaagtacaattaagcct |
22223632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 26872427 - 26872384
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
26872427 |
taaccgcaacttttggaaatataggggttcaaaagtgcaattaa |
26872384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 109
Target Start/End: Original strand, 27421448 - 27421495
Alignment:
| Q |
62 |
aggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| | ||||||||||| |
|
|
| T |
27421448 |
aggactgaacttttgatgtcattgtacaaacagtggagtgttactcac |
27421495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 37047711 - 37047668
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
37047711 |
taaccgcaacttttgaaaaaataggggtccaaaagtgcaattaa |
37047668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38882416 - 38882369
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
38882416 |
taaccgcaacttttgaaaagataggggtacaaaaatgcaattaagcct |
38882369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 39754141 - 39754180
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaa |
40 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
39754141 |
taaccgcaacttttggaaagataggggtccaaaaatgcaa |
39754180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 40790942 - 40790984
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40790942 |
cgcaacttttggaaagatag-gggccaaaagtgcaattaagcct |
40790984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 46622820 - 46622867
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
46622820 |
taaccgcaacctttggaaagataggggttgaaaagtgcaattaagcct |
46622867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 10351073 - 10351119
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| |||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
10351073 |
taaccgtaacttttgaaaagattggggtccaaaagtgcaattaagcc |
10351119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10385515 - 10385469
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
10385515 |
taaccgcaacttttagaaagataagggtctaaaagtgcaattaagcc |
10385469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 11275432 - 11275478
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||| ||||||||| |
|
|
| T |
11275432 |
taaccgcaacttttgaaaagataggggtccaaaggtgtaattaagcc |
11275478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 11742929 - 11742971
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
11742929 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
11742971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 26872627 - 26872673
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
26872627 |
taaccgcaacttttgaaaagataagggtccaaaagtggaattaagcc |
26872673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 34288318 - 34288364
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
34288318 |
taaccgcaacttttaaaaagataggggttcaaaagtgcaattaagcc |
34288364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 39142463 - 39142505
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
39142463 |
caacttttgaaaagataggggaccaaaagtgcaattaagcctt |
39142505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 47259004 - 47258962
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
47259004 |
gcaacttttgaaaagatagagggccaaaaatgcaattaagcct |
47258962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 111
Target Start/End: Original strand, 9355891 - 9355944
Alignment:
| Q |
58 |
tatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||||||||| |||| || ||||||| |
|
|
| T |
9355891 |
tatgagaactaaacttttgatgtcactgtacaaacagtggggtattgctcacta |
9355944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 21782870 - 21782915
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
21782870 |
taaccacaacttttggaaagatagggggtccaaaagtgcaattaag |
21782915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25036078 - 25036033
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| ||| |||| |||| |||||||||||||||| |
|
|
| T |
25036078 |
taaccgcaacttttgaaaatataggggtcaaaaagtgcaattaagc |
25036033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 40436247 - 40436288
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40436247 |
cgcaacttttggaaagataagggtccaaaaatgcaattaagc |
40436288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 47259330 - 47259371
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
47259330 |
caacttttgaaaagatatagggccaaaagtgcaattaagcct |
47259371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 17167896 - 17167853
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
17167896 |
cgcaacttttgaaaagatagggg-ccaaaagtgcaattaagcctt |
17167853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 18201655 - 18201699
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||||||||||||| |
|
|
| T |
18201655 |
cgcaacttttgaaaagacagggggccaaaagtgcaattaagcctt |
18201699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 24236375 - 24236423
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
24236375 |
taaccgcaacttttagaaagatacgggtgcaaaaatgcaattaagcctt |
24236423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 25691606 - 25691646
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
25691606 |
tactataagaactgaactgttgatgccactgtacaaacagt |
25691646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 29163142 - 29163098
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || | ||||||||||||||||||| |
|
|
| T |
29163142 |
cgcaacttttgaaaagatagggggcaaaaagtgcaattaagcctt |
29163098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 29163320 - 29163364
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
29163320 |
cgcaacttttgaaaagatagaaggtcaaaagtgcaattaagcctt |
29163364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 37109962 - 37109918
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||||||||| || ||||||||| || |||||||||||| |
|
|
| T |
37109962 |
gactgaacttttgatgtcattgtacaaacggtggggtgttactca |
37109918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 37452097 - 37452049
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| | || ||||||||||||||||||| |
|
|
| T |
37452097 |
taaccgcaacttttgaaaagatatggatctaaaagtgcaattaagcctt |
37452049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 37996278 - 37996322
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
37996278 |
taaccgcaacttttggaaagataggggatccaaaaatgcaattaa |
37996322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 45
Target Start/End: Original strand, 45480100 - 45480140
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
45480100 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaag |
45480140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 48928366 - 48928414
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||| ||||| ||||||||| |
|
|
| T |
48928366 |
ggactgaacttttgatggcaccgtacaaatagtggggtgctactcacta |
48928414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 48928633 - 48928681
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||| ||||| ||||||||| |
|
|
| T |
48928633 |
ggactgaacttttgatggcaccgtacaaatagtggggtgctactcacta |
48928681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 162)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 33660440 - 33660501
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33660440 |
ttgatgatactaagaggactgaacttttgatgccactgtacaaacagttgggtgttactcac |
33660501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 41463922 - 41463983
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41463922 |
ttgatgatactatgaggattgaacttttgatgccactgtacaaacagtgaggtgttactcac |
41463983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 2325442 - 2325502
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
2325442 |
ttgatgatactatgaggactgaacttttgatgccagtgtacaaacaatggggtgttactca |
2325502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 23000776 - 23000824
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23000776 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
23000824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24857929 - 24857881
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24857929 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaaacctt |
24857881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 29242210 - 29242274
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
29242210 |
ttgatgatactatgaagactgaacttttgataccactgtacaaacagtggggtgttacgcactat |
29242274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 19256856 - 19256903
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19256856 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
19256903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25429968 - 25429921
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25429968 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
25429921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 36642117 - 36642058
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
36642117 |
ttgatgatactatgaggactgaacttttgatgtcactgtacaaacagtgaggtgttactc |
36642058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 1466856 - 1466810
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1466856 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
1466810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 4167046 - 4166992
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
4167046 |
tactatggggactgaacttttgatgccattgtacaaacagtggggtgttactcac |
4166992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 17798894 - 17798848
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17798894 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
17798848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 36987680 - 36987726
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36987680 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
36987726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 4478500 - 4478439
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| | | ||||||||||| |
|
|
| T |
4478500 |
ttgatgatactatgaggactaaacttttgatgccactgtacaaacaatggagtgttactcac |
4478439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 9715118 - 9715163
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9715118 |
accgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
9715163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 39167435 - 39167496
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
39167435 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtgaggtgttactcac |
39167496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 3177070 - 3177010
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| | |||||||||| |
|
|
| T |
3177070 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagttgcgtgttactca |
3177010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 55 - 111
Target Start/End: Complemental strand, 4763755 - 4763699
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4763755 |
tactatgggaactgaacttttgatgtcactgtacaaacagtggggtgttactcacta |
4763699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 17799096 - 17799144
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
17799096 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
17799144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24205340 - 24205292
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
24205340 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
24205292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25430037 - 25430085
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25430037 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
25430085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30218973 - 30219021
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30218973 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
30219021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31784298 - 31784250
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31784298 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
31784250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35699119 - 35699167
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35699119 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
35699167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36566718 - 36566766
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
36566718 |
taaccgcaacttttggaaagataggggtccagaagtgcaattaagcctt |
36566766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40493912 - 40493960
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
40493912 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
40493960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42445418 - 42445370
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42445418 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
42445370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45127103 - 45127151
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45127103 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
45127151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 315064 - 315021
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
315064 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
315021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3263081 - 3263034
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3263081 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcct |
3263034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7537459 - 7537412
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
7537459 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
7537412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 24365137 - 24365180
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24365137 |
taaccgcaacttttggaaagatagaggtccaaaaatgcaattaa |
24365180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24895178 - 24895225
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24895178 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
24895225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 25887940 - 25887893
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25887940 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcct |
25887893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 26717408 - 26717455
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26717408 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaagcct |
26717455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 33551058 - 33551121
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
33551058 |
ttgatgatactatgaagaccgaacttttgatgtcattgtacaaacagtggggtgttactcacta |
33551121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 37905839 - 37905780
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
37905839 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacggtggggtgttactc |
37905780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 41071875 - 41071828
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
41071875 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaagcct |
41071828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 41072095 - 41072142
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41072095 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
41072142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 41829732 - 41829775
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41829732 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaa |
41829775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 1375092 - 1375046
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1375092 |
taaccgtaacttttggaaagataggggtccaaaagtgcaattaagcc |
1375046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21843447 - 21843493
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21843447 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcc |
21843493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22194715 - 22194761
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22194715 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
22194761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 34850924 - 34850970
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34850924 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
34850970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 36987454 - 36987412
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36987454 |
cgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
36987412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 38731325 - 38731279
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38731325 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
38731279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39642775 - 39642729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39642775 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
39642729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 43770926 - 43770972
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
43770926 |
ggactgaacttttgatgccactgtataaacagtggggtgttactcac |
43770972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 5881670 - 5881609
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| | ||||| ||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
5881670 |
ttgatgatactaaggggactcaacttttgatgtcactgtacaaacagtggggtgttactcac |
5881609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 19424700 - 19424761
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| || ||||| | ||||||||||||| |
|
|
| T |
19424700 |
ttgatgatactatgaggactaaacttttgatgccactatataaacaatggggtgttactcac |
19424761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 40506249 - 40506204
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40506249 |
taaccgcaacttttggaaagattggggtccaaaagtgcaattaagc |
40506204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 1375353 - 1375397
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
1375353 |
taaccgcaacttttggaaagataggggtccaaaagttcaattaag |
1375397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 1375428 - 1375472
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
1375428 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
1375472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 1467075 - 1467123
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
1467075 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
1467123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2936835 - 2936787
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
2936835 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagcctt |
2936787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2937056 - 2937103
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
2937056 |
taaccgcaacttttagaaagatagaggtccaaaa-tgcaattaagcctt |
2937103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 3263283 - 3263331
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
3263283 |
taaccgcaacttttagaaagataggggtccaaaagtgcaagtaagcctt |
3263331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7464206 - 7464254
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7464206 |
taaccgtaacttttggaaagataggagtccaaaagtgcaattaagcctt |
7464254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9484747 - 9484703
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9484747 |
taaccgcaacttttggaaagatagaggtttaaaagtgcaattaag |
9484703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 9714911 - 9714855
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgttactat |
60 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||| || ||||||| |
|
|
| T |
9714911 |
ccgcaacttttggaaagataggagttcaaaagtgcaattaagccttaattttactat |
9714855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 11367070 - 11367114
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11367070 |
ccgcaacttttggaaagataagggtccaaaagtgcaattaagcct |
11367114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 19025870 - 19025822
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
19025870 |
taaccgcaacttttgaaaagataggggtcaaaaagtgcaattaagcctt |
19025822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19368760 - 19368808
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19368760 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagcctt |
19368808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22093485 - 22093533
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
22093485 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcctt |
22093533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25888158 - 25888206
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
25888158 |
taaccgtaacttttgtaaagataggggtccaaaagtgcaattaagcctt |
25888206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 26717196 - 26717156
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26717196 |
acttttggaaagataggggtccaaaagtgcaattaagcctt |
26717156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 36286425 - 36286469
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
36286425 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcctt |
36286469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 36589777 - 36589729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36589777 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagcctt |
36589729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36589979 - 36590027
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36589979 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagcctt |
36590027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 39374142 - 39374098
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39374142 |
cgcaacttttgaaaagatagagggccaaaagtgcaattaagcctt |
39374098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39620591 - 39620543
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
39620591 |
taaccgcaacttttggaaagatagggacccaaaagtgcaattaagcctt |
39620543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40445820 - 40445868
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40445820 |
taaccacaacttttagaaagataggggtccaaaagtgcaattaagcctt |
40445868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 41829515 - 41829467
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtcc-aaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
41829515 |
taaccgcaacttttggaaagataggggtccaaaaagtgcaattaagcct |
41829467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 45395277 - 45395233
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
45395277 |
taaccgcaacttttggaaaggtaggggtccaaaagtgcaattaag |
45395233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 315270 - 315317
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
315270 |
taaccgcaacttttagaaagatatgggtccaaaagtgcaattaagcct |
315317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 1374844 - 1374801
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1374844 |
taaccgcaacttttggaaagataggggtctaaaagtgcaattaa |
1374801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 8519312 - 8519269
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
8519312 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaa |
8519269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 8739096 - 8739139
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
8739096 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
8739139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 11362607 - 11362564
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
11362607 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
11362564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 12542428 - 12542471
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12542428 |
cgcaacttttgaaaagatagagggccaaaagtgcaattaagcct |
12542471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13732434 - 13732481
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
13732434 |
taaccgcaacttttagaaagatagggatccaaaagtgcaattaagcct |
13732481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 17096957 - 17096910
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
17096957 |
taaccgcaacttttggaaagttagggatccaaaagtgcaattaagcct |
17096910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 19473282 - 19473325
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19473282 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaa |
19473325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20436104 - 20436057
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20436104 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
20436057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22093281 - 22093234
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
22093281 |
taaccgcaacttttgaaaagataggggtccaaaagtgcatttaagcct |
22093234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24858143 - 24858190
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
24858143 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
24858190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33004755 - 33004708
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33004755 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
33004708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 33709304 - 33709363
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| |||||||| |||||| | ||||||||| |
|
|
| T |
33709304 |
ttgatgatactatggggactgaacttttgatgtcactgtactaacagtggagtgttactc |
33709363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 34123287 - 34123245
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34123287 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaa |
34123245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 34600589 - 34600546
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34600589 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcct |
34600546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 39245936 - 39245979
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39245936 |
cgcaacttttggaaagatatgggtccaaaagtgcaattaagcct |
39245979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 39431215 - 39431172
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
39431215 |
taaccgcaacttttggaaagatagaagttcaaaagtgcaattaa |
39431172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 40445619 - 40445572
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40445619 |
taaccgcaacgtttggaaagatatgggtccaaaagtgcaattaagcct |
40445572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42445639 - 42445686
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
42445639 |
taaccgcaacttttagaaagatagggatccaaaagtgcaattaagcct |
42445686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Original strand, 4264156 - 4264210
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
4264156 |
tactatggagactgaacttttgatgtcactgtacaaacagtgggatgttactcac |
4264210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 10741346 - 10741392
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
10741346 |
aaccgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
10741392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 10857381 - 10857339
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
10857381 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcc |
10857339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 17102576 - 17102622
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
17102576 |
taaccgcaacttttggaaagttaggggttcaaaagtgcaattaagcc |
17102622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 19473122 - 19473076
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
19473122 |
taaccgcaacttttagaaagataggggtccaaaaatgcaattaagcc |
19473076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 21552587 - 21552541
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
21552587 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcc |
21552541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21552808 - 21552854
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21552808 |
taaccgcaacttttgaaaagatatgggtccaaaagtgcaattaagcc |
21552854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 26357691 - 26357645
Alignment:
| Q |
65 |
actgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
26357691 |
actgaacttttgatgtcactgtacaaacagtgggatgttactcacta |
26357645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 27350025 - 27350071
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27350025 |
ggactgaacttttgatgtcactgtacaaacagtgtggtgttactcac |
27350071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 32661706 - 32661748
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32661706 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcc |
32661748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 33902196 - 33902134
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||| |||| |||||||||||||||||||| || | |||||||||| |||| |||||||||| |
|
|
| T |
33902196 |
tgatgatactttgaggactgaacttttgatgtcattttacaaacagtggggtattactcacta |
33902134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39431436 - 39431482
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
39431436 |
taaccgcaacttttaaaaagatagaggttcaaaagtgcaattaagcc |
39431482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 40493692 - 40493646
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40493692 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaagcc |
40493646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 7006993 - 7007054
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| | ||| |||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
7006993 |
ttgatgatactatgggaactaaacttttgatgctactgtacaaacagtgggatgttactcac |
7007054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11366845 - 11366796
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
11366845 |
taaccgcaacttttggaaagatagggggtccaaaagtgtaattaagcctt |
11366796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 13711595 - 13711534
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||| ||| ||||| ||||||||||| |||||||||||| || ||||||||||||| |
|
|
| T |
13711595 |
ttgatgataccatgtggactaaacttttgatgtcactgtacaaactgtggggtgttactcac |
13711534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 15977476 - 15977521
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15977476 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagc |
15977521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 16865360 - 16865319
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
16865360 |
gcaacttttggaaagatagggggccaaaagtgcaattaagcc |
16865319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 22136932 - 22136891
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
22136932 |
aacttttggaaagataggggtctaaaagtgcaattaagcctt |
22136891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 24895015 - 24894970
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
24895015 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagc |
24894970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 32661446 - 32661401
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
32661446 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagccttg |
32661401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 41051277 - 41051314
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactg |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41051277 |
ttgatgatactatgaggactgaacttttgatgccactg |
41051314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 45126885 - 45126840
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
45126885 |
taaccgcaacttttggatatataggggtccaaaagtgcaattaagc |
45126840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 2755221 - 2755265
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
2755221 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcctt |
2755265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11017651 - 11017603
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||| | ||||||||||| |||||||||||| |
|
|
| T |
11017651 |
taaccgcaactttttgaaagattggggtccaaaagtacaattaagcctt |
11017603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13485440 - 13485488
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
13485440 |
taaccgcaacttttgaaaagataggggtataaaagtgcaattaagcctt |
13485488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19026084 - 19026132
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||||| |||| |
|
|
| T |
19026084 |
taaccgcaacttttggaaagatagggattcaaaagtgcaattaaacctt |
19026132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 33004959 - 33005007
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
33004959 |
taaccgcaacttttgaaaagataggggatccaaaagtgcaattaagcct |
33005007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34850723 - 34850675
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
34850723 |
taaccgcaacttttggaaaaataagggtccaaaagtgcaattaaacctt |
34850675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 36286165 - 36286121
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36286165 |
cgcaacttttgaaaatatagagggccaaaagtgcaattaagcctt |
36286121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 36566649 - 36566605
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
36566649 |
taaccgcaacttttgaaaagataggggtccagaagtgcaattaag |
36566605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 38731546 - 38731594
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38731546 |
taactgcaacttttgaaaagataggagtccaaaagtgcaattaagcctt |
38731594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39620815 - 39620863
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
39620815 |
taaccgcaaattttgaaaaaatagaggtccaaaagtgcaatttagcctt |
39620863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 40324897 - 40324941
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtcc-aaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40324897 |
taaccgcaacttttggaaagataggggtccaaaaagtgcaattaa |
40324941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40711382 - 40711334
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| | |||||||||||| |
|
|
| T |
40711382 |
taaccgcaacttttgaaaagataggggtccaaaaatacaattaagcctt |
40711334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 43648317 - 43648377
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
43648317 |
ttgatgatactatgatgactgaacttttgatgtcattatacaaacagtgaggtgttactca |
43648377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45395505 - 45395553
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| |||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
45395505 |
taaccgcaatttttagaaagatagggatccaaaagtgcaattaagcctt |
45395553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 2382824 - 2382871
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
2382824 |
taaccgcaacttttggaaatataggggtttaaaagtgcaattaagcct |
2382871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 3414871 - 3414910
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3414871 |
cgcaacttttggaaagataggggttcaaaagtgcaattaa |
3414910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8738894 - 8738847
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| ||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
8738894 |
taaccgcaatttttgtaaaggtaggggtccaaaagtgcaattaagcct |
8738847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 15023252 - 15023209
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
15023252 |
cgcaacttttaaaaagatagagggccaaaagtgcaattaagcct |
15023209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 20494385 - 20494334
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||||| |||| |
|
|
| T |
20494385 |
taaccacaacttttaaaaagataggggtccaaaagtgcaattaagccatgat |
20494334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22194494 - 22194447
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| || |||||||||| |
|
|
| T |
22194494 |
taaccgcaacttttgaaaagataggggtccaaaaatgaaattaagcct |
22194447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 23000573 - 23000530
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23000573 |
taaccgcaacttttggaaaaataagggtccaaaagtgcaattaa |
23000530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 31025917 - 31025874
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31025917 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
31025874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31784518 - 31784565
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||| ||||||||||||| |
|
|
| T |
31784518 |
taaccgcaacttttgaaaagatagggatccaaaaatgcaattaagcct |
31784565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 40324676 - 40324633
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
40324676 |
cgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
40324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 41454554 - 41454511
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
41454554 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
41454511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 44244992 - 44244949
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
44244992 |
cgcaacttttggaaagataggagaccaaaagtgcaattaagcct |
44244949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 22699502 - 22699456
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
22699502 |
taaccacaacttttgaaaagataggggtccaaaagtacaattaagcc |
22699456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 34470071 - 34470029
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
34470071 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
34470029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 35180557 - 35180598
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
35180557 |
cgcaacttttggaaagatag-gggccaaaagtgcaattaagcc |
35180598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 15977248 - 15977207
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
15977248 |
caacttctggaaaaataggggtccaaaagtgcaattaagcct |
15977207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 19313982 - 19313922
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| ||||||| ||| ||| |||||||||||| |
|
|
| T |
19313982 |
ttgatgatactat-aggactgaacttttgatgtcactgtataaatagtaaggtgttactcac |
19313922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 21568192 - 21568237
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
21568192 |
taaccgcaacttttgaaaagatagggatccaaaaatgcaattaagc |
21568237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 28451681 - 28451640
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
28451681 |
cgcaacttttagaaagatagggggccaaaagtgcaattaagc |
28451640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 30504537 - 30504578
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30504537 |
cgcaacttttaaaaagatagaggaccaaaagtgcaattaagc |
30504578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 34981430 - 34981386
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
34981430 |
taaccgcaacttttgaaaagatag-ggtccaaaaatgcaattaagc |
34981386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5036555 - 5036507
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5036555 |
taaccgcaacttttaaaaagataagagtccaaaagtgcaattaagcctt |
5036507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 13123468 - 13123424
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
13123468 |
taacctcaacttttaaaaagataggggtccaaaagtgcaattaag |
13123424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 19289395 - 19289455
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||| |||| ||| ||||||||||| || |||||||||| | |||||||||||| |
|
|
| T |
19289395 |
ttgatgatactgtgagaacttaacttttgatgtcattgtacaaacaatggggtgttactca |
19289455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 19889489 - 19889533
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
19889489 |
cgcaacttttgaaaagatatggggccaaaagtgcaattaagcctt |
19889533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 22963430 - 22963398
Alignment:
| Q |
149 |
tcattctgatgacttcaccataaaattttccat |
181 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
22963430 |
tcattcttatgacttcaccataaaattttccat |
22963398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 181
Target Start/End: Original strand, 22998047 - 22998079
Alignment:
| Q |
149 |
tcattctgatgacttcaccataaaattttccat |
181 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
22998047 |
tcattcttatgacttcaccataaaattttccat |
22998079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 37343954 - 37343998
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
37343954 |
cgcaacttttgaaaagataggaggccaaaagtgcaattaagcctt |
37343998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40506451 - 40506499
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||| |||| |
|
|
| T |
40506451 |
taaccgcaacttttagaaagataggagaccaaaagtgcaattaaacctt |
40506499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 41454813 - 41454857
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
41454813 |
cgcaacttttgaaaagatagggggccaaacgtgcaattaagcctt |
41454857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Complemental strand, 44286073 - 44286033
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
44286073 |
tactatgtggactaaacttttgatgccactatacaaacagt |
44286033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 216)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 47279316 - 47279255
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
47279316 |
ttgatgatactatgaggactgaactttcgatgccactgtacaaacagtggggtgttactcac |
47279255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 15752156 - 15752092
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
15752156 |
ttgatgatactatgaggactgaacttttgatgccattgtacaaacagtgaggtgttactcactat |
15752092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 21289799 - 21289736
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21289799 |
ttgatgatactatagggactgaacttttgatgccactgtacaaacagtggggtgttactcacta |
21289736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 46320943 - 46320990
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46320943 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
46320990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 18589895 - 18589849
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18589895 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
18589849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22204573 - 22204619
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22204573 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
22204619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 37029195 - 37029241
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37029195 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
37029241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 112
Target Start/End: Original strand, 10182064 - 10182121
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
10182064 |
tactatgaggactgaacttttgatgccactgtacaaacagtggcgtgttacgcactat |
10182121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 23342228 - 23342277
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23342228 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagccttg |
23342277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 922430 - 922478
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
922430 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
922478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 6491462 - 6491414
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6491462 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcctt |
6491414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11018447 - 11018399
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11018447 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
11018399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15161565 - 15161613
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15161565 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
15161613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23356739 - 23356691
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23356739 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
23356691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26861320 - 26861272
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26861320 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
26861272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 27396793 - 27396841
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27396793 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
27396841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 43914624 - 43914576
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43914624 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
43914576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45012678 - 45012630
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45012678 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
45012630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 52233477 - 52233429
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52233477 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
52233429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3384010 - 3383963
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3384010 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcct |
3383963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8774344 - 8774297
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8774344 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
8774297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11051942 - 11051895
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11051942 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
11051895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11204553 - 11204506
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11204553 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
11204506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20471460 - 20471413
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20471460 |
taaccgcaacttttggaaagatagaggtctaaaagtgcaattaagcct |
20471413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20560077 - 20560124
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20560077 |
taaccgcaacttttggaaagatagaggtctaaaagtgcaattaagcct |
20560124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20596130 - 20596177
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20596130 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
20596177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 27227534 - 27227581
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27227534 |
ttgatgatactatgaggactgaacttttgatgccactgtacaaacagt |
27227581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45664407 - 45664454
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45664407 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
45664454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45885216 - 45885263
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45885216 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
45885263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 6183028 - 6182982
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6183028 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
6182982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 9058212 - 9058166
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9058212 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
9058166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 11052164 - 11052210
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11052164 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
11052210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 12071912 - 12071958
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12071912 |
taaccgcaacttttggaaagatagagatccaaaagtgcaattaagcc |
12071958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 23793049 - 23793095
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23793049 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
23793095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 26434957 - 26435003
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26434957 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
26435003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 32341541 - 32341495
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32341541 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
32341495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 40815133 - 40815179
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40815133 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcc |
40815179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 42407152 - 42407198
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42407152 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
42407198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 25098397 - 25098442
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25098397 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
25098442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 48620764 - 48620703
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
48620764 |
ttgatgatactaaggggactgaacttttgatgtcactgtacaaacagtggggtgttactcac |
48620703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 1547413 - 1547353
Alignment:
| Q |
49 |
tgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
1547413 |
tgatgatactatgagaactgaacttttgatgccactgcacaaacagtggagtgttactcac |
1547353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8770509 - 8770461
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8770509 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
8770461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11018669 - 11018717
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
11018669 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
11018717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11204766 - 11204814
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11204766 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
11204814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12690067 - 12690019
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12690067 |
taacctcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
12690019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16491242 - 16491290
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
16491242 |
taaccgcaacttttgaaaagataaaggtccaaaagtgcaattaagcctt |
16491290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 20017648 - 20017692
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20017648 |
cgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
20017692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25820820 - 25820868
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25820820 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
25820868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 28564830 - 28564890
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28564830 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtaaggtgttactca |
28564890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 29704663 - 29704619
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29704663 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaag |
29704619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29794739 - 29794691
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29794739 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
29794691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32341759 - 32341807
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32341759 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
32341807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 36230598 - 36230550
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
36230598 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaaacctt |
36230550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39427457 - 39427409
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39427457 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
39427409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 42721166 - 42721102
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
42721166 |
ttgatgatactatggggattgaacttttgatgttactgtacaaacagtggggtgttactcactat |
42721102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 47113434 - 47113390
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47113434 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
47113390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 52143432 - 52143480
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
52143432 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
52143480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 921799 - 921752
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
921799 |
taaccgcaacttttggaaagatagaggttcaaaagtgtaattaagcct |
921752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 2959867 - 2959812
Alignment:
| Q |
56 |
actatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| || ||||||| |||| |
|
|
| T |
2959867 |
actatgaggactgaacttttgatgtcactgtacaaacagtgggatgttacttacta |
2959812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7598655 - 7598608
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7598655 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaagcct |
7598608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10279944 - 10279991
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10279944 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcct |
10279991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 15161343 - 15161296
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15161343 |
taaccgcaacttttggaaagatatgggtccaaaagtgcaattaagcct |
15161296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22204351 - 22204304
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
22204351 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
22204304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 23342010 - 23341963
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
23342010 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
23341963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 27267248 - 27267311
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
27267248 |
ttgatgatactatggagactgaacttttaatgccactgtacaaacagtggggtgtcactcacta |
27267311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30288222 - 30288175
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30288222 |
taaccgcaacttctggaaagataggggtccaaaagtgcaattaagcct |
30288175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 31797110 - 31797063
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31797110 |
taaccgcaatttttggaaagataggggtccaaaagtgcaattaagcct |
31797063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 32216182 - 32216119
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||| |||||||||||| | ||||||||||||| |
|
|
| T |
32216182 |
ttgatgatactacgaggactgaacttttgacgccattgtacaaacagtggtgtgttactcacta |
32216119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 32558258 - 32558215
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32558258 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
32558215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 34012426 - 34012489
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
34012426 |
ttgatgatagtatgatgactgaacttttgatgccactttacaaacagtggagtgttactcacta |
34012489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 35580780 - 35580729
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgatgtta |
56 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
35580780 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagccttcatgtta |
35580729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39427680 - 39427727
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39427680 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
39427727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 40618776 - 40618729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40618776 |
taaccgcaacttttggaaatataggggtccaaaagtgcaattaagcct |
40618729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 43677149 - 43677102
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43677149 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaagcct |
43677102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45884994 - 45884947
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45884994 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
45884947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 52143211 - 52143168
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52143211 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
52143168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 2371223 - 2371177
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2371223 |
taaccgcaactttttgaaagataggggtccaaaagtgcaattaagcc |
2371177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 3264046 - 3264000
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3264046 |
taaccgtaacttttggaaagataggggtccaaaagtgcaattaagcc |
3264000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 6183249 - 6183295
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6183249 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
6183295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 6491683 - 6491729
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6491683 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
6491729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 8770730 - 8770776
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
8770730 |
taaccgcaacttttggaaaaataggggtccaaaagtgcaattaagcc |
8770776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13791842 - 13791888
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
13791842 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
13791888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22075618 - 22075664
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22075618 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
22075664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 30294916 - 30294870
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
30294916 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
30294870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 38622670 - 38622716
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38622670 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
38622716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 40814932 - 40814887
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40814932 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaagcc |
40814887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 42589466 - 42589420
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
42589466 |
taaccgcaacttttgtaaagatagaagtccaaaagtgcaattaagcc |
42589420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 47764137 - 47764091
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
47764137 |
taaccgcaacttttgaaaaaatagaggtccaaaagtgcaattaagcc |
47764091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 52149781 - 52149827
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
52149781 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
52149827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 3309274 - 3309214
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||| || |||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
3309274 |
ttgatgatactatgaagattgaacttttgataccactgtacaaacagt-gggtgttactcac |
3309214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25820156 - 25820111
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
25820156 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagc |
25820111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 33811694 - 33811739
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
33811694 |
accgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
33811739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 33871164 - 33871209
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
33871164 |
accgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
33871209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 41585552 - 41585597
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41585552 |
taaccgcaacttttaaaaagatagaggtccaaaagtgcaattaagc |
41585597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 14786 - 14738
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
14786 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
14738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 4330408 - 4330344
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt-cgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
4330408 |
ttgatgatactatgatgactgaacttttgatcccactgtacaaacattgggggtgttactcacta |
4330344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7598873 - 7598921
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
7598873 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
7598921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8535783 - 8535831
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8535783 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaaacctt |
8535831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8601022 - 8601070
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8601022 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaaacctt |
8601070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 10922854 - 10922794
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| || |||||||||||| |||| ||||||| |
|
|
| T |
10922854 |
ttgatgatactatgaggattgaacttttgatgtcattgtacaaacagtggggtcttactca |
10922794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12071690 - 12071642
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12071690 |
taaccgcaactttttgaaagataggggtccaaaagtgtaattaagcctt |
12071642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 14460347 - 14460303
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14460347 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaag |
14460303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Complemental strand, 16415773 - 16415709
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaaca-gtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
16415773 |
ttgatgatactatgatggctgaacttttgatgccactgtacaaacatttagggtgttactcacta |
16415709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19830378 - 19830426
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
19830378 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaaacctt |
19830426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 21727882 - 21727926
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
21727882 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
21727926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 25160759 - 25160715
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaac |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25160759 |
ttgatgatactatgaggactgaacttttgatgccattgtacaaac |
25160715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 28503181 - 28503133
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28503181 |
taaccgcaacttttgaaaagatagaggtctaaaagtgtaattaagcctt |
28503133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 32267161 - 32267101
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| || |||||||| ||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
32267161 |
ttgatgataatatgaggagtgaacttttgatgtcattgtacaaacagtggggtgttactca |
32267101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 34988353 - 34988397
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
34988353 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaag |
34988397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 36139412 - 36139364
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
36139412 |
taaccgcaacttttggaaagataggggttcaaaagtgcaattaaacctt |
36139364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 36139624 - 36139664
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaat |
41 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36139624 |
taaccgcaacttttggaaagataggggtccaaaagtgcaat |
36139664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40355894 - 40355846
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
40355894 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaaacctt |
40355846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 40884925 - 40884877
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
40884925 |
ggactgaacttttgatgccaccgtacaaacagtggggtgctactcacta |
40884877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 112
Target Start/End: Complemental strand, 41926290 - 41926226
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||| |||||| ||||||||||| ||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
41926290 |
ttgatgatactatagggactgaacttgtgatgccactgtacaaacagtgggatattactcactat |
41926226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42406929 - 42406881
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
42406929 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcctt |
42406881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 47113654 - 47113702
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
47113654 |
taaccgcaaattttgaaaagataggggtccaaaagtgcaattaagcctt |
47113702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 49056389 - 49056437
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
49056389 |
taaccgcaacttttggaaagatagggggtccaaaagtgcaattaagcct |
49056437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1480512 - 1480555
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1480512 |
taaccgcaacttttggaaagataggggtacaaaagtgcaattaa |
1480555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 6809114 - 6809067
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
6809114 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
6809067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8029006 - 8028959
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
8029006 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
8028959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9332949 - 9332906
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
9332949 |
taaccgcaacttttgaaaagatagagctccaaaagtgcaattaa |
9332906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9356722 - 9356679
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
9356722 |
taaccgcaacttttgaaaagatagagctccaaaagtgcaattaa |
9356679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 9903103 - 9903166
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || |||| ||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9903103 |
ttgatgatagtatgtggattgaacttttgatgtcactgtacaaacagcggggtgttactcacta |
9903166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 106
Target Start/End: Original strand, 11742414 - 11742457
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
11742414 |
ggactgaacttttgatgtcactgtacaaacagtggggtgttact |
11742457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 14758160 - 14758105
Alignment:
| Q |
56 |
actatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||| | ||| ||||||||| |
|
|
| T |
14758160 |
actatggggactgaacttttgatgccaccgtacaaacagttgtgtgctactcacta |
14758105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16491020 - 16490973
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
16491020 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
16490973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 18422778 - 18422719
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
18422778 |
ttgatgatattatgaggactgaacttttgatgtcattgtacaaacggtggggtgttactc |
18422719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20224343 - 20224390
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
20224343 |
taaccgcaacttttgaaaagataggggtccaaaagtacaattaagcct |
20224390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20287813 - 20287766
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
20287813 |
taaccgcaacttttggaaaggtagggttccaaaagtgcaattaagcct |
20287766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 20359265 - 20359308
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
20359265 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
20359308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20471679 - 20471726
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
20471679 |
taaccgcaacttttggaaagataggggttcaaaaatgcaattaagcct |
20471726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 20551705 - 20551662
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
20551705 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaa |
20551662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20559858 - 20559811
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
20559858 |
taaccgcaacttttggaaagataggggttcaaaaatgcaattaagcct |
20559811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 21727658 - 21727615
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21727658 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaa |
21727615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 23208573 - 23208620
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
23208573 |
taaccgcaacttttggaaagataggggtccaaaagtacaactaagcct |
23208620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29794961 - 29795008
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
29794961 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattatgcct |
29795008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30295137 - 30295184
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
30295137 |
taaccacaacttttagaaagataggggtccaaaagtgcaattaagcct |
30295184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37028974 - 37028927
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37028974 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
37028927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 38823341 - 38823282
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
38823341 |
ttgatgatactatggggattgaacttttgatgacactgtacaaatagtggggtgttactc |
38823282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43914847 - 43914894
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43914847 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
43914894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44846964 - 44846917
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
44846964 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
44846917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 180
Target Start/End: Original strand, 47682543 - 47682674
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgg-gtgttactcactatcnnnnnnnatgctagtgttaacttcaccnnnnnn |
146 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| ||||||||||| |||| || ||||||||||| | | |||||||||||||||||||| |
|
|
| T |
47682543 |
ttgatgatactatgaggaatgaacttttgataccactgtacaagcagtgggagtgttactcac-aacattttttatgctagtgttaacttcacc-aaaaa |
47682640 |
T |
 |
| Q |
147 |
nntcattctgatgacttcaccataaaattttcca |
180 |
Q |
| |
|
||| ||| |||||||||||||||||||||||| |
|
|
| T |
47682641 |
agtcactctcatgacttcaccataaaattttcca |
47682674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 49056170 - 49056123
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
49056170 |
taaccgcaacttttggaaagatagggggtccaaaagtgcaattaagcc |
49056123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 52149563 - 52149520
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
52149563 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
52149520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2371444 - 2371490
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2371444 |
taaccgcaactttttaaaagataggggtccaaaagtgcaattaagcc |
2371490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 8774564 - 8774610
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8774564 |
taactgcaacttttggaaagataagggtccaaaagtgcaattaagcc |
8774610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 9517296 - 9517250
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
9517296 |
taaccgcaacttttgaaaagataggggtccaaaagagcaattaagcc |
9517250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 12061628 - 12061586
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12061628 |
cgcaacttttggaaagatagagggtcaaaagtgcaattaagcc |
12061586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 23356961 - 23357003
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatta |
43 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
23356961 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaatta |
23357003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 23792826 - 23792780
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
23792826 |
taaccgcaacttttggaaagataggtgtccaaaagtgtaattaagcc |
23792780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 27855609 - 27855563
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
27855609 |
taaccgcaacttttgaaaagataggggttcaaaagtgcaattaagcc |
27855563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 28503403 - 28503449
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28503403 |
taaccgtaacttttgaaaagataggggtccaaaagtgcaattaagcc |
28503449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 41585331 - 41585285
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
41585331 |
taaccgcaacttttgaaaagatagagatccaaaaatgcaattaagcc |
41585285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 43670581 - 43670627
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
43670581 |
taaccgcaacttttggaaatataggggtccaaatgtgcaattaagcc |
43670627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 43677369 - 43677414
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
43677369 |
taaccgcaacttttgaaaagatag-ggtccaaaagtgcaattaagcc |
43677414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 46320722 - 46320676
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
46320722 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcc |
46320676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 49227383 - 49227429
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
49227383 |
taaccgcgacttttggaaagttaggggtccaaaagtgcaattaagcc |
49227429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 8029224 - 8029269
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
8029224 |
taactgcaacttttggaaagatagggatccaaaagtgcaattaagc |
8029269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 9053669 - 9053718
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
9053669 |
taaccgcaacttttgaaaagatagggggtccaaaagtgcaattaagcctt |
9053718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 13791622 - 13791573
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
13791622 |
taaccgcaacttttggaaagataggagtccaaaagtacaattaaaccttg |
13791573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 15911714 - 15911669
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
15911714 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagccttg |
15911669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 20224124 - 20224079
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
20224124 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagc |
20224079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 105
Target Start/End: Original strand, 27533029 - 27533086
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttac |
105 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
27533029 |
ttgatgatactatggggattgaacttttgatgccactgtacaaagagtgggttgttac |
27533086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 30288466 - 30288511
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30288466 |
taaccgcaactttttaaaagatagagatccaaaagtgcaattaagc |
30288511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2372679 - 2372727
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
2372679 |
taaccgcaacttttaaaaagataggggtccaaaattgcaattaagcctt |
2372727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2383392 - 2383344
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
2383392 |
taaccgcaacttttaaaaagataggggtccaaaattgcaattaagcctt |
2383344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 104
Target Start/End: Original strand, 7079112 - 7079168
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtta |
104 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
7079112 |
ttgatgatactatgatgactgaacttttgatgtcattgtacaaacagtgaggtgtta |
7079168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 14460569 - 14460617
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
14460569 |
taaccgcaacttttagaaagataggggtccaaaagtacaattaaacctt |
14460617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 28769779 - 28769720
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||| || |||||||||||| |
|
|
| T |
28769779 |
ttgatgatactatgaggaccgaacctttgatgccattgtacaaacggt-gggtgttactca |
28769720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 30289414 - 30289458
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30289414 |
taaccgtaacttttggaaagatatgggtccaaaagtgcaattaag |
30289458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 30327001 - 30327061
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| | ||||||||| || |||| ||||||| |
|
|
| T |
30327001 |
ttgatgatactatgatgactgaacttttgatgctattgtacaaacggttgggtattactca |
30327061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 45680137 - 45680093
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
45680137 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaag |
45680093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 49227166 - 49227118
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||| |||| |
|
|
| T |
49227166 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaaacctt |
49227118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 51272945 - 51272993
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
51272945 |
taaccgcaactttttgaaagataagggtctaaaagtgcaattaagcctt |
51272993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 52363446 - 52363490
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
52363446 |
taaccgcaacttttggaaagataggggtcaaaaaatgcaattaag |
52363490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 4243176 - 4243133
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
4243176 |
taaccgcaacttttagaaagataggggtccaaaagtacaattaa |
4243133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4243394 - 4243441
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
4243394 |
taaccgcaacttttaaaaagatagggatccaaaagtgcaattaagcct |
4243441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 9517513 - 9517556
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
9517513 |
taaccgcaacttttaaaaagataggggtccaaaagtgcaattaa |
9517556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 19899818 - 19899877
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
19899818 |
ttgatgatactatgagggttgaacttttgatgccattctacaaacagtgaggtgttactc |
19899877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22071209 - 22071166
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
22071209 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaa |
22071166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 26434755 - 26434712
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
26434755 |
taaccgtaacttttggaaagataggggttcaaaagtgcaattaa |
26434712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 26932884 - 26932923
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
26932884 |
cgcaacttttggaaagatagggggccaaaagtgcaattaa |
26932923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 112
Target Start/End: Original strand, 27563971 - 27564018
Alignment:
| Q |
65 |
actgaacttttgatgccactgtacaaacagtcgggtgttactcactat |
112 |
Q |
| |
|
||||||||||||||| |||| |||||||||| | |||||||||||||| |
|
|
| T |
27563971 |
actgaacttttgatgtcactatacaaacagtggagtgttactcactat |
27564018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 30254550 - 30254503
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagt |
95 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
30254550 |
ttgatgatactttgaggactgaacttttgatgtcattgtacaaacagt |
30254503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 83
Target Start/End: Original strand, 33725649 - 33725684
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccac |
83 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33725649 |
ttgatgatactatgaggactgaacttttgatgccac |
33725684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38622449 - 38622402
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| ||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
38622449 |
taactgcaacttctgaaaagataggggtccaaaagtgcaattaagcct |
38622402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 50591599 - 50591556
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
50591599 |
cgcaacttttggaaagataaggggccaaaagtgcaattaagcct |
50591556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 109
Target Start/End: Original strand, 238569 - 238622
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||| || |||||||||| |
|
|
| T |
238569 |
tactatggggactgaacttttgatgtcattgtacaaacagt-ggatgttactcac |
238622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 47
Target Start/End: Original strand, 866419 - 866457
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
866419 |
acttttggaaagatagggatccaaaagtgcaattaagcc |
866457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 109
Target Start/End: Complemental strand, 3535044 - 3534998
Alignment:
| Q |
63 |
ggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
3535044 |
ggactgaacttttgatgtcactgcacaaacagtaaggtgttactcac |
3534998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 7159549 - 7159507
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7159549 |
cgcaacttttggaaagatagggggtcaaaagtgcaattaagcc |
7159507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 7489549 - 7489511
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
7489549 |
caacttttggaaagatagggggccaaaagtgcaattaag |
7489511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 7764453 - 7764495
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
7764453 |
gcaacttttgaaaagatagggggccaaaagtgcaattaagcct |
7764495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Complemental strand, 15168223 - 15168181
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaa |
90 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15168223 |
ttgatgatactatggggactgaacttttgatgccaccgtacaa |
15168181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 44
Target Start/End: Original strand, 24183356 - 24183394
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24183356 |
gcaacttttgaaaagatagaggaccaaaagtgcaattaa |
24183394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 32038106 - 32038152
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
32038106 |
taaccacaacttttagaaagatagggatccaaaagtgcaattaagcc |
32038152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 47
Target Start/End: Complemental strand, 33777204 - 33777166
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
33777204 |
acttttagaaagataggggtccaaaagtgcaattaagcc |
33777166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 106
Target Start/End: Complemental strand, 37451412 - 37451355
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttact |
106 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| || ||||||||| || |||||||||| |
|
|
| T |
37451412 |
ttgatgatacta-gaggactgaacttttgatgtcattgtacaaacggtagggtgttact |
37451355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 46351495 - 46351537
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
46351495 |
gcaacttttgaaaagataggggaccaaaagtgcaattaagcct |
46351537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 51272723 - 51272677
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||| | |||||||||||| ||||||| |||||||||| |
|
|
| T |
51272723 |
taaccgcaactttcgaaaagatagaggttcaaaagtacaattaagcc |
51272677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 13098077 - 13098032
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
13098077 |
taaccgcaactttttaaaagatagggatccaaaagtgcaattaagc |
13098032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 19830157 - 19830116
Alignment:
| Q |
4 |
ccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
19830157 |
ccgcaactttttgaaagataagggtccaaaagtgcaattaag |
19830116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 48
Target Start/End: Original strand, 20288024 - 20288061
Alignment:
| Q |
11 |
ttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20288024 |
ttttggaaagatatgggtccaaaagtgcaattaagcct |
20288061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30289215 - 30289166
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagagg-tccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
30289215 |
taaccacaacttttggaaagatagggggtctaaaagtgcaattaagcctt |
30289166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 34988136 - 34988091
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
34988136 |
taaccgcaacttttgaaaagataggggtccaaaagtataattaagc |
34988091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 1712412 - 1712368
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
1712412 |
cgcaacttttgaaaagatagggggtcaaaagtgcaattaagcctt |
1712368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 15383060 - 15383000
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||| || |||||||||||||||| || ||||||||| || || ||||||||| |
|
|
| T |
15383060 |
ttgatgatactacgatgactgaacttttgatgacattgtacaaacggtgggatgttactca |
15383000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 16150017 - 16150060
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16150017 |
cgcaatttttgaaaagatagagg-ccaaaagtgcaattaagcctt |
16150060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 20017428 - 20017384
Alignment:
| Q |
1 |
taaccgcaacttttggaaagata-gaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
20017428 |
taaccgtaacttttggaaagatagggggtccaaaagtgcaattaa |
20017384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Complemental strand, 23999467 - 23999415
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactc |
107 |
Q |
| |
|
|||||||||| |||||||||||||| || | |||||| ||| ||||||||||| |
|
|
| T |
23999467 |
tactatgagggctgaacttttgatgtcattctacaaatagtggggtgttactc |
23999415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 26932624 - 26932581
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
26932624 |
cgcaacttttgaaaagataggggtc-aaaagtgcaattaagcctt |
26932581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 45
Target Start/End: Complemental strand, 29153236 - 29153196
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
29153236 |
cgcaacttttgagaagatagagggccaaaagtgcaattaag |
29153196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 31621602 - 31621662
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||| ||||||| || ||||| |||||| |
|
|
| T |
31621602 |
ttgatgatactatggggactgaatttttgatgccaccgtacaaatagcggggtgctactca |
31621662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 103
Target Start/End: Original strand, 37618950 - 37618998
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgtt |
103 |
Q |
| |
|
||||||||| ||||||||||||||| || | |||||||||| ||||||| |
|
|
| T |
37618950 |
tactatgagaactgaacttttgatgtcattttacaaacagtggggtgtt |
37618998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 51128986 - 51128926
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| |||||| | |||||||||||||||| || ||||||||| || | |||||||||| |
|
|
| T |
51128986 |
ttgatgatactataatgactgaacttttgatgtcattgtacaaacggtggagtgttactca |
51128926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 52201407 - 52201364
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
52201407 |
cgcaacttttgaaaagatagggg-ccaaaagtgcaattaagcctt |
52201364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 48; Significance: 1e-18; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 10895 - 10946
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10895 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagccttgat |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 16185 - 16236
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16185 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagccttgat |
16236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 10670 - 10627
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
10670 |
cgcaacttttggaaagataggggtctaaaagtgcaattaagcct |
10627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 15960 - 15917
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15960 |
cgcaacttttggaaagataggggtctaaaagtgcaattaagcct |
15917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 120)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 2100426 - 2100379
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2100426 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
2100379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 7391744 - 7391791
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7391744 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
7391791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 10894137 - 10894183
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10894137 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
10894183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 15491746 - 15491685
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
15491746 |
ttgatgatactatgagggctgaacttttgatgccactgtacaaatagtggggtgttactcac |
15491685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 1896944 - 1896896
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1896944 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
1896896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5606564 - 5606612
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5606564 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcctt |
5606612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7391531 - 7391483
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7391531 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
7391483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 10893935 - 10893887
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10893935 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
10893887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11746044 - 11745996
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11746044 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
11745996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 15273044 - 15272996
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15273044 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
15272996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20080164 - 20080116
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20080164 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
20080116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28563587 - 28563635
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28563587 |
taaccgcaactttttgaaagatagaggtccaaaagtgcaattaagcctt |
28563635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4405508 - 4405555
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4405508 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
4405555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 6261644 - 6261691
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6261644 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
6261691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 11213450 - 11213497
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11213450 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
11213497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 12257031 - 12257078
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12257031 |
taaccgcaacttttggaaagataaaggtccaaaagtgcaattaagcct |
12257078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13042454 - 13042407
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13042454 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
13042407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 23291302 - 23291255
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23291302 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
23291255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 26716638 - 26716685
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26716638 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
26716685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31951468 - 31951515
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31951468 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
31951515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 6261427 - 6261381
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6261427 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
6261381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13042675 - 13042721
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13042675 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
13042721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 20630616 - 20630662
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20630616 |
taaccgcaacttttggaaagatagaggtctaaaagtgcaattaagcc |
20630662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 25750001 - 25749955
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25750001 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
25749955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 8513364 - 8513303
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| || |||| ||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8513364 |
ttgatgatattatggggactgaacttttgatgtcactgtacaaacagtggggtgttactcac |
8513303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 92
Target Start/End: Complemental strand, 18498566 - 18498521
Alignment:
| Q |
47 |
cttgatgttactatgaggactgaacttttgatgccactgtacaaac |
92 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18498566 |
cttgatgatactatgaggactgaacttttgatgccactgtacaaac |
18498521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 28930510 - 28930465
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28930510 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagc |
28930465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 1815243 - 1815291
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
1815243 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
1815291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2565124 - 2565076
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2565124 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
2565076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2565346 - 2565394
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2565346 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
2565394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20630398 - 20630350
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20630398 |
taaccgcaacttttggaaagataggggtccataagtgcaattaagcctt |
20630350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27765304 - 27765256
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27765304 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaatcctt |
27765256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30965959 - 30966007
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30965959 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcctt |
30966007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 31741038 - 31741082
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31741038 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaag |
31741082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31833533 - 31833581
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31833533 |
taaccgcaatttttggaaagataggggtccaaaagtgcaattaagcctt |
31833581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 11322292 - 11322339
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11322292 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
11322339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 11446022 - 11445979
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11446022 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaa |
11445979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11614944 - 11614897
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
11614944 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcct |
11614897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14997055 - 14997008
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
14997055 |
taaccgcaacttttggaaagataggggtccaaaaatgcaattaagcct |
14997008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 14997276 - 14997323
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14997276 |
taaccgcaacttttgcaaagataggggtccaaaagtgcaattaagcct |
14997323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 16735832 - 16735879
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
16735832 |
taaccgcaacttttggaaaaataggggtccaaaagtgcaattaagcct |
16735879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 21003414 - 21003367
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
21003414 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
21003367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27223576 - 27223623
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27223576 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcct |
27223623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28931995 - 28931948
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28931995 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcct |
28931948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29697110 - 29697157
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29697110 |
taactgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
29697157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 1815022 - 1814976
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1815022 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
1814976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10977704 - 10977658
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10977704 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
10977658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 11746246 - 11746292
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
11746246 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
11746292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 16765087 - 16765041
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16765087 |
taaccgcaacttttggaaagataggggtccaaaagtacaattaagcc |
16765041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 18683058 - 18683012
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18683058 |
taaccacaacttttgaaaagatagaggtccaaaagtgcaattaagcc |
18683012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 21009016 - 21009058
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21009016 |
caacttttggaaagatagaggtccaaaagtgtaattaagcctt |
21009058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 23585251 - 23585293
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23585251 |
caacttttggaaagataggggtccaaaagtgcaattaagcctt |
23585293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 23883355 - 23883401
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
23883355 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
23883401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 28930731 - 28930777
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28930731 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcc |
28930777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 28932904 - 28932950
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28932904 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcc |
28932950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 34705643 - 34705689
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34705643 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcc |
34705689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 1897146 - 1897195
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
1897146 |
taaccgcaacttttggaaagataggggttcaaaaatgcaattaagccttg |
1897195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 3879992 - 3880053
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
3879992 |
ttgatgatactatggggattgaacttttgatgtcattgtacaaacagtagggtgttactcac |
3880053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 6089039 - 6088978
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
6089039 |
ttgatgatactatggtgactgaacttttgatgccactttacaaacagtggggcgttactcac |
6088978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 18683277 - 18683326
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttg |
50 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
18683277 |
taaccgcaacttttggaaaaataggggtccaaaagtgaaattaagccttg |
18683326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 21017165 - 21017226
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||||||| | | ||||||||||||| |
|
|
| T |
21017165 |
ttgatgatactatggggactgaacttttgatgccattgtacaaataatggggtgttactcac |
21017226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 22279545 - 22279500
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22279545 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagc |
22279500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 31833312 - 31833267
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
31833312 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagc |
31833267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 3195762 - 3195718
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3195762 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaag |
3195718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 3534844 - 3534800
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
3534844 |
taaccgcaacttttggaaagataggggtccaaaagtgtaattaag |
3534800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 4318876 - 4318936
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||| || ||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
4318876 |
ttgatgatactatgggggttgaacttttgatgtcactgtacaaacagtggggtgttactca |
4318936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 9703811 - 9703859
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
9703811 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaaacctt |
9703859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11277672 - 11277624
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
11277672 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcctt |
11277624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12256810 - 12256762
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
12256810 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattacgcctt |
12256762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 14168618 - 14168574
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
14168618 |
cgcaacttttgaaaagatagagggccaaaagtgcaattaagcctt |
14168574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 26171478 - 26171522
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26171478 |
cgcaagttttggaaagataggggtccaaaagtgcaattaagcctt |
26171522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30239471 - 30239519
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
30239471 |
taactgcaacttttggaaagataggggtctaaaagtgcaattaagcctt |
30239519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31740815 - 31740767
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31740815 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
31740767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 2100648 - 2100695
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2100648 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
2100695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3185424 - 3185471
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
3185424 |
taaccgcaacttttgaaaagataggggaccaaaagtgcaattaagcct |
3185471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3535046 - 3535089
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3535046 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
3535089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5606342 - 5606295
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
5606342 |
taaccgcaacttttgaaaagatagggatccaaaagtgcaattaagcct |
5606295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 9126650 - 9126689
Alignment:
| Q |
9 |
acttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9126650 |
acttttggaaagataggggtccaaaagtgcaattaagcct |
9126689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13440143 - 13440190
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13440143 |
taaccgcaacttttggaaagataagagtccaaaagtgcaattaagcct |
13440190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 15273246 - 15273289
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
15273246 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
15273289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28563373 - 28563326
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28563373 |
taaccgcaacttttagaaaggtaggggtccaaaagtgcaattaagcct |
28563326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 29696894 - 29696847
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
29696894 |
taaccgcaacttttgaaaagataggggtctaaaagtgcaattaagcct |
29696847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30965737 - 30965690
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30965737 |
taactgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
30965690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 15149773 - 15149727
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15149773 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaagcc |
15149727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 23883135 - 23883089
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23883135 |
taaccgcaacttttgaaaagataagggtccaaaagtgcaattaagcc |
23883089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 108
Target Start/End: Complemental strand, 1945958 - 1945905
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||| |||||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
1945958 |
tactatgagggctgaacttttgatgtcattctacaaacagtggggtgttactca |
1945905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 29182278 - 29182233
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
29182278 |
gactgaacttttgatgacactgtataaacagtggggtgttactcac |
29182233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 30818264 - 30818219
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
30818264 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaatcaagc |
30818219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 4037080 - 4037036
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
4037080 |
cgcaacttttgaaaagatagggggccaaaagtgcaattaagcctt |
4037036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 4037478 - 4037518
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4037478 |
caacttttggaaagacagaggaccaaaagtgcaattaagcc |
4037518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 111
Target Start/End: Original strand, 7235095 - 7235150
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||||||||| ||||| ||||||||| |
|
|
| T |
7235095 |
tactatgag-actgaacttttgatggcaccgtacaaacagtggggtgctactcacta |
7235150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15149995 - 15150043
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||| |||| |
|
|
| T |
15149995 |
taaccgcaacttttgaaaagataggggtctaaaagtgcaattaaacctt |
15150043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 15711681 - 15711637
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatag-aggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
15711681 |
taaccgcaacttttgaaaagataggaggtccaaaagtgcaattaa |
15711637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15711903 - 15711951
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
15711903 |
taaccgcaacttttaaaaagataggggtcgaaaagtgcaattaagcctt |
15711951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 28960270 - 28960226
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
28960270 |
cgcaacttttggaaagatagggggccaaaagtacaattaagcctt |
28960226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30818482 - 30818530
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| | | |||||||||||||||||||| |
|
|
| T |
30818482 |
taaccgcaacttttgaaaagatagggattcaaaagtgcaattaagcctt |
30818530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3194703 - 3194750
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3194703 |
taaccgcaacttttagaaagatatgagtccaaaagtgcaattaagcct |
3194750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 6091236 - 6091299
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||| || |||||||||| | | ||||||||||||| |
|
|
| T |
6091236 |
ttgatgatactacgagtactgaacttttgatggcattgtacaaacaatggtgtgttactcacta |
6091299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 10977925 - 10977968
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
10977925 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaa |
10977968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 11277884 - 11277927
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
11277884 |
taaccgcaacttttgaaaagataggggtccaaaagtacaattaa |
11277927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20080366 - 20080413
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
20080366 |
taaccgcaacttttacaaagataggggtccaaaagtacaattaagcct |
20080413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 33618965 - 33618922
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaa |
91 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
33618965 |
ttgatgatactatgagaactgaacttttgatgccaccgtacaaa |
33618922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 34705421 - 34705374
Alignment:
| Q |
2 |
aaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||| |||||||||||||| |
|
|
| T |
34705421 |
aaccgcaacttttgaaaatataggggtccaaaaatgcaattaagcctt |
34705374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 26479310 - 26479356
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||| |||||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
26479310 |
taactgcaacttttggaaaaatagggatccaaaagtgcaattaagcc |
26479356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 3185279 - 3185238
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3185279 |
taacctcaacttttggaaagataggggtcctaaagtgcaatt |
3185238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 108
Target Start/End: Complemental strand, 5627515 - 5627462
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||||||| |||||||||||||| || | |||||| ||| |||||||||||| |
|
|
| T |
5627515 |
tactatgagggctgaacttttgatgtcattctacaaatagtggggtgttactca |
5627462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 6324243 - 6324202
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
6324243 |
gcaacttttgaaaagatagggggccaaaagtgcaattaagcc |
6324202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 84
Target Start/End: Complemental strand, 20768208 - 20768179
Alignment:
| Q |
55 |
tactatgaggactgaacttttgatgccact |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20768208 |
tactatgaggactgaacttttgatgccact |
20768179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 33274271 - 33274230
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
33274271 |
aacttttgaaaagatagggggccaaaagtgcaattaagcctt |
33274230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 378510 - 378553
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
378510 |
cgcaacatttggaaagataggggtc-aaaagtgcaattaagcctt |
378553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10255787 - 10255835
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
10255787 |
taactgcaacttttaaaaagataggggtccaaaagtgcaattaaacctt |
10255835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 11307347 - 11307391
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
11307347 |
cgcaacttttgaaaagataggaggccaaaagtgcaattaagcctt |
11307391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11321948 - 11321900
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
11321948 |
taaccacaacttttaaaaaaataggggtccaaaagtgcaattaagcctt |
11321900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 13439919 - 13439875
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
13439919 |
cgcaacttttggaaagataggagttcaaaagtgcaattaatcctt |
13439875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 14168989 - 14169033
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
14168989 |
cgcaaattttgaaaagatagggggccaaaagtgcaattaagcctt |
14169033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 16765315 - 16765351
Alignment:
| Q |
12 |
tttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16765315 |
tttgtaaagataggggtccaaaagtgcaattaagcct |
16765351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17965885 - 17965837
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| ||||||||| |||||||| | ||||||||||||||||| |||| |
|
|
| T |
17965885 |
taaccccaacttttgaaaagatagggatccaaaagtgcaattaaacctt |
17965837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22279765 - 22279813
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||| ||||| |||||||| ||| ||||||||||||||| |||| |
|
|
| T |
22279765 |
taaccgcaatttttgaaaagataggggttcaaaagtgcaattaaccctt |
22279813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31951251 - 31951203
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||| |||| |
|
|
| T |
31951251 |
taaccgcaacttttaaaaagataggggtccaaaaatgcaattaaacctt |
31951203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 33265128 - 33265084
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||| |||| |
|
|
| T |
33265128 |
cgcaacttttagaaagatagggggccaaaagtgcaattaaacctt |
33265084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 265 - 204
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcac |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
265 |
ttgatgatactatgaggactgaacttttgatgccattgtacaaacagtggagtgttactcac |
204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 94437 - 94500
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactcacta |
111 |
Q |
| |
|
|||||| || |||| |||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
94437 |
ttgatgatagtatggggaccaaacttttgatgccactgtacaaacagtggggtgttactcacta |
94500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5638 - 5590
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5638 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
5590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5860 - 5908
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5860 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
5908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7767 - 7719
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7767 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
7719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 7988 - 8033
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7988 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagc |
8033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 8018 - 7958
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
8018 |
ttgatgatactatgaggactgaacttttgatgtcattgtacaaacagtggggtgttactca |
7958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 45; Significance: 8e-17; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20914 - 20866
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20914 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaagcctt |
20866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 21118 - 21164
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
21118 |
accgcaacttttggaaagataggggtccaaaaatgcaattaagcctt |
21164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10828 - 10875
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
10828 |
taaccgcaacttttgaaaagataggggtccaaaaatgcaattaagcct |
10875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 49
Target Start/End: Complemental strand, 10600 - 10557
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
10600 |
gcaactttggaaaagataggggtccaaaagtgcaattaagcctt |
10557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29696 - 29648
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29696 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
29648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 29918 - 29969
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagccttgat |
52 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29918 |
taaccgtaacttttggaaagataggggtccaaaagtgcaattaagccttgat |
29969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 400973 - 401021
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
400973 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcctt |
401021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 400750 - 400703
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
400750 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
400703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 100 - 147
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
100 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4788 - 4835
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4788 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
4835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 45
Target Start/End: Complemental strand, 4583 - 4543
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
4583 |
cgcaacttttgaaaagataagggtccaaaagtgcaattaag |
4543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 6914 - 6867
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6914 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
6867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 14572 - 14615
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14572 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
14615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 81569 - 81616
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
81569 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
81616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 81351 - 81306
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
81351 |
taaccacaacttttggaaagataggggttcaaaagtgcaattaagc |
81306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 238891 - 238938
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
238891 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
238938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 238668 - 238621
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
238668 |
taaccacaacttttgaaaagataggggtccaaaagtgcaattaagcct |
238621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 16021 - 16067
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16021 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
16067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21314 - 21360
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21314 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
21360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 21108 - 21066
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
21108 |
cgcaaattttggaaagatagggatccaaaagtgcaattaagcc |
21066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 22341 - 22295
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22341 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
22295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22543 - 22589
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaagcc |
22589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 26514 - 26555
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26514 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaatt |
26555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 26309 - 26264
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagc |
46 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
26309 |
taaccgcaacttttgaaaagataggagttcaaaagtgcaattaagc |
26264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 9993 - 9945
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9993 |
taaccgcaacttttggaaagataggagtccaaaagtgcaattaagcctt |
9945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10204 - 10252
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10204 |
taaccgcaacttttagaaagataggggtccaaaaatgcaattaagcctt |
10252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21884 - 21836
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
21884 |
taaccgcaacttttggaaagttaggggtccaaaagtgcaattaagcctt |
21836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20641 - 20593
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20641 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcctt |
20593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 12093 - 12050
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12093 |
taaccgcaacttttgaaaagatagaggtccaaaagtgcaattaa |
12050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20881 - 20928
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
20881 |
taaccgcaacttttggaaagataggggtccaaaagtgcaaataagcct |
20928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20893 - 20941
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20893 |
taaccgcaacttttggaaagataagggtccaaaagtgcaattaagcctt |
20941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 12925 - 12973
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
12925 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcctt |
12973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 79036 - 78988
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
79036 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaagcctt |
78988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 79254 - 79301
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
79254 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaagcct |
79301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 861 - 818
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
861 |
cgcaacttttggaaagataggggtccaaaagtgcaattaagcct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3751 - 3708
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3751 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
3708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 137 - 184
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
137 |
taaccgcaacttttagaaagataggggtccaaaagtgcaattaagcct |
184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 139441 - 139484
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
139441 |
taaccgcaacttttggaaagataggggtccaaaagtgcaattaa |
139484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 139221 - 139173
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
139221 |
taaccgcaacttttggaaagatagggatccaaaagtgcaattaaacctt |
139173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 1603 - 1650
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
1603 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaaacctt |
1650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 1399 - 1353
Alignment:
| Q |
3 |
accgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
1399 |
accgcaacttttgaaaagatagggatccaaaagtgcaattaagcctt |
1353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 2690 - 2646
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaag |
45 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2690 |
taaccacaacttttggaaagataggggtccaaaagtgcaattaag |
2646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 44088 - 44028
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
44088 |
ttgatgatactatgaggactgaactttttatgccattgtacaaacaacggggtgttactca |
44028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3828 - 3781
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
3828 |
taaccgcaacttttggaaagatag-ggtccaaaagtgcaattaggcctt |
3781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 122601 - 122645
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
122601 |
cgcaacttttggaaagatagggggccaaaagtgcaattaagcctt |
122645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 154699 - 154759
Alignment:
| Q |
48 |
ttgatgttactatgaggactgaacttttgatgccactgtacaaacagtcgggtgttactca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
154699 |
ttgatgatactatgaggactgaactttttatgccattgtacaaacaacggggtgttactca |
154759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 75156 - 75108
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
75156 |
taacggcaacttttggaaaaataggggtccaaaagtgcaattaagcctt |
75108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 75342 - 75385
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
75342 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaa |
75385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8977 - 9024
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
8977 |
taaccacaacttttggaaagataggggtccaaaaatgcaattaagcct |
9024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 1230 - 1187
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
1230 |
taaccgcaacttttgaaaagataggggtccaaaagtgcaattaa |
1187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1451 - 1494
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaa |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1451 |
taaccgcaacttttgaaaagataggagtccaaaagtgcaattaa |
1494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 809 - 762
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
809 |
taaccgcaacttttggaaagataggggtctaaaaatgcaattaagcct |
762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1014 - 1061
Alignment:
| Q |
1 |
taaccgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| | ||||||||||| |
|
|
| T |
1014 |
taaccgcaacttttagaaagatagagatccaaaaatacaattaagcct |
1061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 23119 - 23161
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
23119 |
cgcaacttttgaaaagatagaggaccaaaagtgcaattaagcc |
23161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 22859 - 22816
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22859 |
cgcaacttttggaaagataaggggccaaaagtgcaattaagcct |
22816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 32020 - 31979
Alignment:
| Q |
6 |
gcaacttttggaaagatagaggtccaaaagtgcaattaagcc |
47 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32020 |
gcaacttttggaaagatagggggccaaaagtgcaattaagcc |
31979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 32281 - 32325
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
32281 |
cgcaacttttggaaagatagggggccaaaagtacaattaagcctt |
32325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 1319 - 1363
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1319 |
cgcaacttttggaaagataaggggccaaaagtgcaattaagcctt |
1363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 47147 - 47193
Alignment:
| Q |
8 |
aacttttggaaagatagaggtccaaaagtgcaattaagccttgatgt |
54 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||| |||| |
|
|
| T |
47147 |
aacttttggaaagatagggggccaaaagtgcagttaagcctttatgt |
47193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0767 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0767
Description:
Target: scaffold0767; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 3606 - 3647
Alignment:
| Q |
7 |
caacttttggaaagatagaggtccaaaagtgcaattaagcct |
48 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
3606 |
caacttttggagagatagagggccaaaagtgcaattaggcct |
3647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 112
Target Start/End: Complemental strand, 267399 - 267350
Alignment:
| Q |
64 |
gactgaacttttgatgccactgtac-aaacagtcgggtgttactcactat |
112 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| || ||||||||||||| |
|
|
| T |
267399 |
gactgaacttttgatgacactgtacaaaacagttggatgttactcactat |
267350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2010 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold2010
Description:
Target: scaffold2010; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 535 - 491
Alignment:
| Q |
5 |
cgcaacttttggaaagatagaggtccaaaagtgcaattaagcctt |
49 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
535 |
cgcaacttttgaaaagatagggggtcaaaagtgcaattaagcctt |
491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University