View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11579_low_25 (Length: 271)

Name: NF11579_low_25
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11579_low_25
NF11579_low_25
[»] chr2 (1 HSPs)
chr2 (26-207)||(42846749-42846928)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 26 - 207
Target Start/End: Complemental strand, 42846928 - 42846749
Alignment:
26 gagggagggagtaatagaatagaataaaaatcacttgacagacagcataatgctctaattcagttttaagctttcaaacattaagtcccacatcgta--- 122  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||   |||||||||  |||||||||| |||       
42846928 gagggagggaataatagaatagaataaaaatcacttgacagacagcataatgctctaattcatttttaa---ttcaaacat--agtcccacattgtagag 42846834  T
123 ttgtgaggaatagagttcaaaatttcctataaaacagcaccgtttgctatagaaatacctaactggataagagaatgccaggcaa 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
42846833 ttgtgaggaatagagttcaaaatttcctataaaacagcaccgtttgctgtagaaatacctaactggataagagaatgccaggcaa 42846749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University