View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11579_low_31 (Length: 222)
Name: NF11579_low_31
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11579_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 36125956 - 36126149
Alignment:
| Q |
10 |
cgagagagaagaacgacgtatggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaa |
109 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125956 |
cgagcgagaagagcgacgtatggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaa |
36126055 |
T |
 |
| Q |
110 |
tgaagatttagcaatgtgggtggaatctatagtgagggaagggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126056 |
tgaagatttagcaatgtgggtggaatctatagtgagggatgggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaa |
36126149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University