View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11579_low_31 (Length: 222)

Name: NF11579_low_31
Description: NF11579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11579_low_31
NF11579_low_31
[»] chr8 (1 HSPs)
chr8 (10-203)||(36125956-36126149)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 36125956 - 36126149
Alignment:
10 cgagagagaagaacgacgtatggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaa 109  Q
    |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36125956 cgagcgagaagagcgacgtatggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaa 36126055  T
110 tgaagatttagcaatgtgggtggaatctatagtgagggaagggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaa 203  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36126056 tgaagatttagcaatgtgggtggaatctatagtgagggatgggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaa 36126149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University