View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1157_low_11 (Length: 435)
Name: NF1157_low_11
Description: NF1157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1157_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 7 - 421
Target Start/End: Complemental strand, 14143186 - 14142772
Alignment:
| Q |
7 |
ggtgttatataggtgattttaatgcaattttggaagctagtgagcatagaggtaggttagatcctgctaggatccctatgtctgattttcaagattggtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14143186 |
ggtgttatataggtgattttaatgcaattttggaagctagtgagcatagaggtaggttagatcctgctaggatccctatgtctgattttcaagattggtc |
14143087 |
T |
|
| Q |
107 |
cagtaataatgatttgctgcatttaccaactagaggagcctggtttacttggaataatggtagaggaggtagagctcatatagaaagaaggcttgataag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14143086 |
cagtaataatgatttgctgcatttaccaactagaggagcctggtttacttggaataatggtagaggaggtagagctcatatagaaagaaggcttgatagg |
14142987 |
T |
|
| Q |
207 |
acaatttgcaatcagttatggttgaatttctgctcaacaatgtcttgttccactttaacaaaattaagttctgatcatttccccttgttactagaatttc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14142986 |
acaatttgcaatcagttatggttgaatttctgctcaacaatgtcttgttccactttaacaaaattaagttctgatcatttccccttgttactagaatttc |
14142887 |
T |
|
| Q |
307 |
aatacaatgagtgtaattttaaatcccatttcaaattcatgaagatgtggtcgttgaaggatgatagcagatctctaattgctaatagttggaatgctaa |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
14142886 |
aatacaatgagtgtaattttaaatcccatttcaaattcatgaagatgtggtcgttgaaggatgattgcagatctctaattgctaatagttggaatgcaaa |
14142787 |
T |
|
| Q |
407 |
tgtcattggttgccc |
421 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14142786 |
tgtcattggttgccc |
14142772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University