View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1157_low_14 (Length: 330)
Name: NF1157_low_14
Description: NF1157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1157_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 243
Target Start/End: Complemental strand, 54243884 - 54243677
Alignment:
| Q |
36 |
ccatgaaatggaaaagataaaaagggaggaggaagacaatgggagaggaagagcgtgagattaaaatgcgtcatattgtttgattttgactcggatatcc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54243884 |
ccatgaaatggaaaagataaaaagggaggaggaagacaatgggagaggaagagcgtgagattaaaatgcgtcatattgtttgattttgactcggatatcc |
54243785 |
T |
|
| Q |
136 |
tctgcgcgtaactacataaattaattacctcaagtaggataggtcctcaataggcggcaaagttttttctcaagatatttgacattgttgcattccccca |
235 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
54243784 |
tctgcacgtaactacataaattaattacctcaagcaggataagtcctcaataggtggcaaagtttttgctgaagatatttgacattgttgcattccccca |
54243685 |
T |
|
| Q |
236 |
acaagacc |
243 |
Q |
| |
|
|||||||| |
|
|
| T |
54243684 |
acaagacc |
54243677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 252 - 325
Target Start/End: Complemental strand, 54243632 - 54243559
Alignment:
| Q |
252 |
ttctagattcgattgattccaactacaacatgttcttgttgttctaatttattattttgttgatattcttcgac |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
54243632 |
ttctagattcgattgattccaactacaacatgttcttgttgttctaatttatgattttgttgatgttgttcgac |
54243559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University