View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11580_low_7 (Length: 241)
Name: NF11580_low_7
Description: NF11580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11580_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 57 - 233
Target Start/End: Complemental strand, 29188580 - 29188404
Alignment:
| Q |
57 |
ccaattaatgtgtaattatttgattgattactaggttctttatgtatgtgattgttcttgtcatttctttgatttaagtagtagagttgcacgagaaaag |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188580 |
ccaattaatgtgtaattatttgattgattactaggttctttatgtatgtgattgttcttgtcatttctttgatttaagtagtagagttgcacgagaaaag |
29188481 |
T |
 |
| Q |
157 |
aaccaaatcttgtgtctttgagaattacctgctttagttctggtttatttattagtaggttcctttttggtgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29188480 |
aaccaaatcttgtgtctttgagaattacctgctttagttctggtttatttattagtaggttcctttttggtggtgtc |
29188404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 29188838 - 29188773
Alignment:
| Q |
1 |
ttggtaaatatctcactgctctaatttatctttaggtttttattacctgaactgaaccaattaatg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
29188838 |
ttggtaaatatctcactgctctaatttatctttaggtttttattacctgaattgtaccaattaatg |
29188773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 207
Target Start/End: Original strand, 29264083 - 29264118
Alignment:
| Q |
172 |
ctttgagaattacctgctttagttctggtttattta |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29264083 |
ctttgagaattacctgctttagttttggtttattta |
29264118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University