View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_high_43 (Length: 266)
Name: NF11581_high_43
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 7167108 - 7167147
Alignment:
| Q |
18 |
ataaaaactagtcgatctactacatttgttccactcaaac |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7167108 |
ataaaaactagtcgatctactacatttgttccactcaaac |
7167147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 255
Target Start/End: Original strand, 7167390 - 7167421
Alignment:
| Q |
224 |
gatttgcaatgggtgtaatatctttccttcat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7167390 |
gatttgcaatgggtgtaatatctttccttcat |
7167421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University