View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_high_44 (Length: 253)
Name: NF11581_high_44
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_high_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 36357230 - 36356978
Alignment:
| Q |
11 |
cacagaaccaagttcatcaatgaaacaaaacccctctcaatttcacatctcagnnnnnnnnnn----------gttaaccctccagttctcaggtggaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36357230 |
cacagaaccaagttcatcaatgaaacaaaacccctctcaatttcacatctcagttttttttgtttttctttttgttaaccctccagttctcaggtggaat |
36357131 |
T |
 |
| Q |
101 |
gagaccctagtattccagagttcgaccaggaggtacaaagtctaaccgacgattgttccacccaggaatcaaactctgttttttccatgattacatctca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36357130 |
gagaccctagtattccagagttcgaccagaaggtacaaagtctaaccgacgattgttccacccaggaatcaaactctgtttttcccatgattacatctca |
36357031 |
T |
 |
| Q |
201 |
aagtttttgtttttcaaacaaataattaaacaaatacatgatcatccaataac |
253 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36357030 |
aagttttttttttttaaacaaataattaaacaaatgcatgatcatccaataac |
36356978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University