View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_high_54 (Length: 238)
Name: NF11581_high_54
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 38718148 - 38718269
Alignment:
| Q |
1 |
aaaaatcatatcaactaaatgtataacacatttaccattttgaagcttttgctcacccaaacatgtctaaagtgatgggagtaatgccaaaaattaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38718148 |
aaaaatcatatcaactaaatgtataacacatttaccattttgaagcttttgctcacccaaacatgtctaaagtgatgggagtaatgccaaaaattaatta |
38718247 |
T |
 |
| Q |
101 |
tattagatggcataagacatgc |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38718248 |
tattagatggcataagacatgc |
38718269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 118 - 222
Target Start/End: Original strand, 38718308 - 38718412
Alignment:
| Q |
118 |
catgcatttcattggatttagttaccattgattgaacgtgttagatgaacccatgtgatccactatttaccaagatatcaattttatatcttctagccat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38718308 |
catgcatttcattggatttagttaccattgattgaacgtgttagatgaacccatgtgatccactatttaccaagatatcaattttatatcttctagccat |
38718407 |
T |
 |
| Q |
218 |
gattc |
222 |
Q |
| |
|
||||| |
|
|
| T |
38718408 |
gattc |
38718412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University