View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_high_61 (Length: 203)
Name: NF11581_high_61
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 4195110 - 4194990
Alignment:
| Q |
10 |
agagtgtgagaatgtgtgtggtgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195110 |
agagtgtgagaatgtgtgtgatgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat |
4195011 |
T |
|
| Q |
110 |
caggtaaactaggccctacta |
130 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4195010 |
caggtaaactaggccctacta |
4194990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University