View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_25 (Length: 396)
Name: NF11581_low_25
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 33543173 - 33542974
Alignment:
| Q |
18 |
acagattggatgataaatcagtgagtgctattaatatgagttaagtagtgtttagactaaattgtttttctttctgcttcaaccaaagccaagtaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33543173 |
acagattggatgataaatcagtgagtgctattaatatgagttaagtagtgtttatactaaagtgtttttctttctgcttcaaccaaagccaagtaaattt |
33543074 |
T |
|
| Q |
118 |
gattgttttagacttttagtagcagatatttttcacttgcttccaagatcaccaaacaactcacaatgaatcttccacaaataaaccaatttattttttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33543073 |
gattgttttagacttttagtagcagatatttttcacttgcttccaagatcaccaaacaactcacaatgaatcttccacaaataaaccaatttattttttg |
33542974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 280 - 396
Target Start/End: Complemental strand, 33542910 - 33542792
Alignment:
| Q |
280 |
cttctatacctcacaccataatagaaaaaatccaaaagatattcagaaagtggacaactacaagtctccaaatcctacagaa--gcatagaaactatttt |
377 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33542910 |
cttctatacctcacaccataatggaaaaaatccaaaagatattcagaaagtggacaactacaagtctccaaatcctacagaagcgcatagaaactatttt |
33542811 |
T |
|
| Q |
378 |
cctatgtgtcagcttttct |
396 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33542810 |
cctatgtgtcagcttttct |
33542792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University