View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_28 (Length: 365)
Name: NF11581_low_28
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 19 - 355
Target Start/End: Original strand, 36356431 - 36356767
Alignment:
| Q |
19 |
aaaaattcggtgacacacgttgaaacctatctgcgcaacgcatttatgcattcttaattcttctgcttctgctattattatctgttatgaagaagttaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356431 |
aaaaattcggtgacacacgttgaaacctatctgcgcaacgcatttatgcattcttaattcttctgcttctgctattattatctgttatgaagaagttaac |
36356530 |
T |
 |
| Q |
119 |
cagtggtggttgttattatagttattgttattgtttcatcatcctcttctcactctcatggaatttcaatttctcaggtcttctttccgagaattccgtg |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356531 |
cggtggtggttgttattatagttattgttattgtttcatcatcctcttctcactctcatggaatttcaatttctcaggtcttctttccgagaattccgtg |
36356630 |
T |
 |
| Q |
219 |
aatgaatcaatgcattgttgtatagagtgattctttctgnnnnnnnatataattcttttgagggatttggaacaggttttgttgatactaagaaaggttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356631 |
aatgaatcaatgcattgttgtatagagtgattctttctatttttttatataattcttttgagggatttggaacaggttttgttgatactaagaaaggttt |
36356730 |
T |
 |
| Q |
319 |
tgaggttgttgttggttttctagatggggaaatgtca |
355 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36356731 |
tgaggttgttgttggttctctagatggggaaatgtca |
36356767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University