View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_34 (Length: 322)
Name: NF11581_low_34
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 12 - 316
Target Start/End: Original strand, 43506634 - 43506938
Alignment:
| Q |
12 |
atgaattatccacttttgttcatcaatctcaggaggccgaggaagggcaacaatctcttccaattgacgtaacaaatgtgcttcgaggtcgacgagttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43506634 |
atgaattatccacttttgttcatcaatctcaggaggccgaggaagggcaacaatctcttccaattgacgtaacaaatgtgcttcgaggtcgacgagttta |
43506733 |
T |
 |
| Q |
112 |
gccttggcattgtcgacttcttcgtgggtgggccgatcgcctatgaggttgaggactgatcgggcttgtgagacgtcggagatggcgtgggtcatcgcgg |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43506734 |
gccttcgcattgtcgacttcttcgtgggtgggccgatcgcctatgaggttgaggactgatcgggcttgtgagacgtcggagatggcgtgggtcatcgcgg |
43506833 |
T |
 |
| Q |
212 |
cgaggagttttgggtctgtgagattgggcatttggccgatgattgaggaggagggtggtggttgttcgacatcggatttagatggtgaggatttggaggt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43506834 |
cgaggagttttgggtctgtgagattgggcatttggccgatgattgaggaggagggtggtggttgttcgacatcggatttagatggtgaggatttggaggt |
43506933 |
T |
 |
| Q |
312 |
gaagg |
316 |
Q |
| |
|
||||| |
|
|
| T |
43506934 |
gaagg |
43506938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University