View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_51 (Length: 250)
Name: NF11581_low_51
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 86 - 242
Target Start/End: Original strand, 37183435 - 37183591
Alignment:
| Q |
86 |
ctgttattgtctgttttctcttttagcataacaaacttcttcataatctgccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
185 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37183435 |
ctgttatcgtctgttttctcttttagcataacaaacttcttcataatctcccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
37183534 |
T |
|
| Q |
186 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37183535 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctc |
37183591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 86 - 242
Target Start/End: Original strand, 37194567 - 37194723
Alignment:
| Q |
86 |
ctgttattgtctgttttctcttttagcataacaaacttcttcataatctgccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
185 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37194567 |
ctgttatcgtctgttttctcttttagcataacaaacttcttcataatctcccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
37194666 |
T |
|
| Q |
186 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37194667 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctc |
37194723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University