View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_56 (Length: 240)
Name: NF11581_low_56
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 50766309 - 50766134
Alignment:
| Q |
19 |
cagagacaaaggaaggaaaatatacgggttcttatccattaaagagacatattattcaattttttgtaaaatatatttattcgatgctggattatgagag |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50766309 |
cagagacaaaggaaggaaaatatatgggttcttatccattaaagagacatattattcaattttttgtaaaatatatttattcgatgctggattatgagag |
50766210 |
T |
|
| Q |
119 |
attattgggcatcgatctc---nnnnnnnnggtttgagaggttggatttgtatcatgggataatgtatcaatttat |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50766209 |
attattgggcatcgatctctttttttttttggtttgagaggttggatttgtatcatgggataatgtatcaatttat |
50766134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 29996632 - 29996707
Alignment:
| Q |
21 |
gagacaaaggaaggaaaatatacgggttcttatccattaaagagacatattattcaattttttgtaaaatatattt |
96 |
Q |
| |
|
|||||||| ||||||| ||||| | |||| |||||| |||| | ||| ||||||||||||||| ||| |||||||| |
|
|
| T |
29996632 |
gagacaaatgaaggaagatatatgagttcatatccaataaatatacaaattattcaattttttataatatatattt |
29996707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University