View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11581_low_59 (Length: 238)

Name: NF11581_low_59
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11581_low_59
NF11581_low_59
[»] chr5 (2 HSPs)
chr5 (1-122)||(38718148-38718269)
chr5 (118-222)||(38718308-38718412)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 38718148 - 38718269
Alignment:
1 aaaaatcatatcaactaaatgtataacacatttaccattttgaagcttttgctcacccaaacatgtctaaagtgatgggagtaatgccaaaaattaatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38718148 aaaaatcatatcaactaaatgtataacacatttaccattttgaagcttttgctcacccaaacatgtctaaagtgatgggagtaatgccaaaaattaatta 38718247  T
101 tattagatggcataagacatgc 122  Q
    ||||||||||||||||||||||    
38718248 tattagatggcataagacatgc 38718269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 118 - 222
Target Start/End: Original strand, 38718308 - 38718412
Alignment:
118 catgcatttcattggatttagttaccattgattgaacgtgttagatgaacccatgtgatccactatttaccaagatatcaattttatatcttctagccat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38718308 catgcatttcattggatttagttaccattgattgaacgtgttagatgaacccatgtgatccactatttaccaagatatcaattttatatcttctagccat 38718407  T
218 gattc 222  Q
    |||||    
38718408 gattc 38718412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University