View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11581_low_64 (Length: 219)
Name: NF11581_low_64
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11581_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 11285477 - 11285294
Alignment:
| Q |
17 |
tgaaatgcttccaagtggttttcttattagaccatgcgaggggggtggatccattattcatattgttgatcacgtggatttagatgtaaggggcatattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11285477 |
tgaaatgcttccaagtggttttcttattagaccatgcgaggggggtggatccattattcatattgttgatcacgtggatttagatgtaaggggtatattt |
11285378 |
T |
 |
| Q |
117 |
aatttcagatttgtttcgtaacttactgttgaacttttctgactttagtatttaacatttttctttcaggtttggagtgtccctg |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11285377 |
aatttcaaatttgtttcgtaacttactgttgaacttttctgacttcagtatttaacattttt-tttcaggtttggagtgtccctg |
11285294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University