View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_22 (Length: 382)
Name: NF11582_high_22
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 50 - 365
Target Start/End: Original strand, 51810705 - 51811020
Alignment:
| Q |
50 |
gatgtatttttattaaatgacaatgtaaataatagatcttttctcgttctataacttgaagaccaaattctcctcgaaccctttgctctcatgctaacct |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51810705 |
gatgtatttttattatatgacaatgtaaataatatatcttttctcgttctataacttgaagaccaaattctcctcgaaccctttgctctcatgctaacct |
51810804 |
T |
 |
| Q |
150 |
ttttccttcatcatcgttcgatcgtgttgactttcttgggtcatactaggcttttcttttcttatttataagtttacgacttgcaaacacataagggttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51810805 |
ttttccttcatcatcgttcgatcgtgttgactttcttgggtcatactaggcttttcttttcttatttataagtttacgacttacaaacacataagggttc |
51810904 |
T |
 |
| Q |
250 |
aaattgtgaagaaaagtctcactgatatatgaaaaacttgggagagagttaccattcaagaggttacaccgtctattttcttattctaattttgtcacaa |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51810905 |
aaattgtgaagaaaagtctcactggtatatgaaaaacttgggagagagttactattcaagaggttacaccgtctattttcttattctaattttgtcacaa |
51811004 |
T |
 |
| Q |
350 |
gatttatcatgaaagg |
365 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51811005 |
gatttatcatgaaagg |
51811020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University