View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_27 (Length: 354)
Name: NF11582_high_27
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 26 - 171
Target Start/End: Complemental strand, 34120911 - 34120766
Alignment:
| Q |
26 |
taatgtttatgatggatcataatgttgtgaatttcttgctatcatcaatatgaaagggtcccattggtaaaacaattgagtggcttatagactcatcatc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120911 |
taatgtttatgatggatcataatgttgtgaatttcttgctatcatcaatatgaaagggtcccattggtaaaacaattgagtggcttatagactcatcatc |
34120812 |
T |
 |
| Q |
126 |
agccatgactctttcagcccatgtgtatcaactcatcatataatat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120811 |
agccatgactctttcagcccatgtgtatcaactcatcatataatat |
34120766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 248 - 334
Target Start/End: Complemental strand, 34120691 - 34120605
Alignment:
| Q |
248 |
tgttattgaaaaacagcataaagctagtatatagtggatatgtttgatnnnnnnntcactacgattgtattagatttttgattattc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
34120691 |
tgttattgaaaaacagcataaagctagtatatagtggatatgtttgataaaaaaatcactacaattgtattagatttctgattattc |
34120605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University